2015 CSU Biotechnology Symposium
Posters with Author Listings and Abstracts
Poster #: 1
Project Title: Using competition assays to test whether genes regulated by the Sinorhizobium meliloti response regulator ChvI have roles in symbiosis
Author List:
Balderas, D.; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
White, H.; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Gluckman, E.; Undergraduate, Biological Science, California State University, Fullerton
Chen, E.; Faculty, Biological Science, California State University, Fullerton
Abstract: Background: Sinorhizobium meliloti is a gram-negative bacterium that lives freely in soil or forms a symbiotic relationship with Medicago sativa (alfalfa). S. meliloti relies on its two-component signaling system, ExoS/ChvI, for the regulation of genes that control succinoglycan production, biofilm formation, motility, and nutrient utilization. A previous study in our lab identified genes that are targets of ChvI by comparing gene expression levels in a chvI gain of function mutant and chvI partial loss of function mutant. To determine if genes regulated by ChvI are important for the endosymbiotic relationship between S. meliloti and M. sativa, we performed symbiosis experiments with knockout mutants of these genes.
Methods: The four genes tested in competition assays were smb20809, smc02832, smc00084, and smc01774. M. sativa seedlings were inoculated with a 1:1 mixture of each knockout mutant and wild-type S. meliloti and incubated in a growth chamber for 28 days. Nodules were observed 14 and 28 days post inoculation (dpi) to determine if the nodules were capable of fixing nitrogen. After 28 dpi, 2 nitrogen-fixing nodules from each plant were crushed and the contents were plated to determine the percent of nodules occupied by the mutant or wild type strains.
Results: Competition experiments with the smc02832, smc00084, and smc01774 knockout mutants showed no significant differences in the proportions of nodules occupied by the mutant versus wild type strains. However, preliminary results indicate that the smb20809 mutant has a defect in symbiosis. Plants inoculated with the smb20809 mutant showed decreased epicotyl stem length, a decreased number of nodules, and a decreased number of nitrogen-fixing nodules per plant. In competition experiments, the smb20809 mutant strain was recovered from nodules much less frequently than the wild-type strain.
Conclusion: The symbiosis defect revealed by the competition experiment with the smb20809 mutant indicates that this gene has an important role in symbiosis. Since smb20809 is involved in capsular polysaccharide synthesis, our results imply that capsular polysaccharides are involved in the endosymbiotic relationship between S. meliloti and the host plant M. sativa.
Acknowledgements: Funding for this project has been provided by NSF grant IOS-0818981 to E.J.C and the CSU Special Fund for Research, Scholarship, Creative Activity, and Possible External Funding.
Poster #: 2
Project Title: A comparison of two arbuscular mycorrhizal fungi specific primers for analysis of diversity and community composition from unused agricultural soil
Author List:
Simonoff-Smith, Alisa; Graduate, Biological Sciences, California State University, Sacramento, Presenting Author
LeGro, Melanie; Undergraduate, Biological Sciences, California State University, Sacramento
Tan, Tina; Undergraduate, Biological Sciences, California State University, Sacramento
Ewing, Nicholas; Faculty, Biological Sciences, California State University, Sacramento
Abstract: Mycorrhizal fungi form symbiotic relationships with plant roots and upwards of 95% of present-day species of plants belong to families that form these relationships. Arbuscular mycorrhizal fungi (AMF) penetrate the roots of their host plants and form branched arbuscules within their cortical cells, with which they exchange nutrients. There has been an increasing interest in the roles and diversity of AMF in many environments, especially as new molecular methods of identification became available. The development of molecular approaches has increased our ability to accurately identify and survey the number of species present.
High AMF genetic diversity makes it challenging to design primers. Primers may fail to amplify all AMF orders and may amplify DNA of non-target organisms. The purpose of our research was to compare the diversity, community structure, and non-target amplification of two primer sets developed relatively recently for identification of a wide range of AMF species using ribosomal DNA genes; the “Lee” set targets a 800 bp fragment of the small subunit and the “Krüger” set a 1500 bp fragment spanning part of the small subunit, the internal transcribed spacers and part of the large subunit. We collected soil samples from unused agricultural land adjacent to Cordova Creek in Rancho Cordova, CA, a site being restored to a riparian environment in 2015. DNA extractions were amplified by each primer in separate reactions, cloned into a TA vector and transformed into competent E. coli cells for growth on media plates. Plasmid DNA was isolated from individual colonies and subjected to DNA sequencing. We analyzed approximately 40 sequences amplified by each primer. Sequence similarities to published sequences from cultured spores was determined by using the Basic Local Alignment Search Tool (BLAST, GenBank) and phylogenetic analysis was carried out on our sequences and their closest matches to determine sequence identity using SeaView. Comparisons of diversity were done by calculating richness and the Shannon-Weiner Index for each primer and comparing with t-tests. To determine if overall community composition differed between primers a correlation test was performed using relative abundances. We found that the Krüger primers tended to yield the highest AMF diversity, even though agricultural soils are often low in diversity. Future work includes using these primers in an ongoing study of AMF diversity during the Cordova Creek restoration process.
Poster #: 3
Project Title: 16S rDNA Sequence Analysis of Beetle Microbiome in Los Angeles and Their Associated Nematodes
Author List:
Koneru, Sneha; Staff, Biology, California State University, Northridge
Gonzalez, Michael; Undergraduate, Biology, California State University, Northridge, Presenting Author
Salinas, Heilly; Undergraduate, Biology, California State University, Northridge, Presenting Author
Hong, Ray; Faculty, Biology, California State University, Northridge
Abstract: Advances in high-throughput DNA sequencing of ecological samples have enabled unprecedented insight into host-microbe associations. However, the microbes mediating the interaction between insects and nematodes– possibly the most species-rich and ubiquitous animal phyla on Earth– have received paltry attention. To address this deficit, we surveyed the nematode and microbial composition of the scarab beetles over a 5-year period (2010-2014) in greater Los Angeles. These necromenic nematodes infect specific beetle species and wait for the hosts to die to resume development by feeding on the microorganisms on the decaying cadaver. The nematodes’ preference of the beetle hosts may be explained by the differences in beetle chemical profiles and species-specific microbiome (the aggregate of microorganisms that exist on the surface and inside a host). Therefore, we tested the hypothesis that Cyclocephala, Serica, and Amblonoxia beetles differ in their microbiome profiles using 16S rDNA high-throughput sequencing on the Illumina MiSEQ platform. 16S rDNA sequencing is a technique that allows the identification and taxonomic classification of bacterial species using the hypervariable regions of 16S rRNA gene, even when bacterial species cannot be cultured in the laboratory. Samples from 2013 from 28 beetles suggest significant differences in the microbiome of these different beetles and their dominant nematode affiliates. Bolstered by this preliminary finding, we greatly expanded our sample size to the microbiome of 285 beetles, along with the microbiome of the 78 wild nematodes isolated directly from the beetles. This approach will enable us to discover which subset of bacteria from the beetle microbiome is actually consumed by the nematodes and thus potentially form the basis for their interactions. Given that anthropogenic pressures play a dominant role in shaping urban ecosystems, our results may serve an informative starting point towards understanding the dynamic interactions between host-parasite relationships and their microbiome in a major US metropolitan area.
Poster #: 4
Project Title: Structure-Function Studies of Thermodesulfovibrio yellowstonii ADPGlucose Pyrophosphorylase: Probing the Role of Phenylalanine-23 in Regulation
Author List:
Pushkarev, Edward; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Yik, Eric; Graduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Susoeff, Michael; Graduate, Chemistry and Biochemistry, California State University, Fullerton
Silva, Oscar; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Meyer, Christopher; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Abstract: Numerous industries have increased interest in the use of biodegradable materials, such as glucans, in an effort to lower their carbon footprint. ADP Glucose Pyrophosphorylase (ADPG PPase) catalyzes the rate limiting step of starch and glycogen biosynthesis in plants and bacteria, respectively. Understanding the structure-function relationship of ADPG PPase can help in increasing glucan yield. The ADPG PPase from Thermodesulfovibrio yellowstonii (Td.y), a thermophilic, sulfate reducing bacteria represents a diverse form of the enzyme, which has properties that could be useful for enhancing starch production in an industrial setting. Further, sequence alignment data indicates that Td.y harbors some amino acid substitutions in a conserved N-terminal region (FRSKPSV in Td.y vs. RRAKPAV consensus) that is known to be important for function and regulation in other characterized ADPG PPases. The differences in the N-terminus conserved sequence may be in part responsible for the altered activation profile. The role of phenylalanine-23 (F23) will be studied by substitution with the positively charged consensus sequence amino acid arginine (R) at this position. The F23R enzyme was generated by site-directed mutagenesis and the recombinant altered Td.y enzyme was successfully expressed in E.coli and purified using hydroxyapatite and size exclusion chromatography. Initial kinetic analyses in the absence of effector molecules revealed that the F23R enzyme displayed a 4 fold decrease in activity and a ~2-fold decrease in apparent affinity for ATP compared to wild-type (WT). However, in the presence of effectors, ATP affinity was restored to WT values. In the presence of 2 mM PEP and 2 mM FBP, F23R displays a ~7 fold increase in activation. Further, effector screening revealed an increased number of metabolites that activate the enzyme compared to WT, including NADP+, F6P, pyruvate, NADH. Current kinetic data suggests that phenylalanine may play a role in enzyme conformation, regulation, and allosteric specificity. Complete kinetic characterization of the F23R enzyme and other N-terminal altered proteins is underway. Supported in part by grants from NSF (BIO MCB 0448676), NIH (2T34GM008612-17), and the U.S. Department of Education (P031C110116-12).
Poster #: 5
Project Title: Origins of tetraploidy in Penstemon heterophyllus and Penstemon parvulus examined using chloroplast DNA haplotype analysis
Author List:
VanDyke, Jennifer; Undergraduate, Biological Sciences, California State University, Sacramento, Presenting Author
Datwyler, Shannon; Faculty, Biological Sciences, California State University, Sacramento
Abstract: Polyploidy, or an increase in the base chromosome number, is a common mechanism for genomic change and speciation in plants. This can occur as a result of a spontaneous doubling of the genome (autopolyploidy) or as a result of hybridization followed by chromosome doubling (allopolyploidy). In this study, we examined a polyploid species complex in Penstemon (Plantaginaceae). Penstemon is the largest genus of plants endemic to North America with approximately 275 species and, although rare within the genus, polyploidy has been documented in several species complexes. Subsection Heterophylli includes several species throughout California, including two diploid, two tetraploid, one hexaploid and one octoploid species. Previous studies demonstrated that P. azureus (6x) is the result of allopolyploid speciation and preliminary morphological evidence suggests that P. neotericus (8x) is also an allopolyploid. However, little is known about the two tetraploid species in this complex. In this study, we used chloroplast DNA haplotype analysis to determine whether the tetraploid species, P. parvulus and P. heterophyllus 4x cytotype, have resulted from a single origin of tetraploidy or whether results suggest independent origins of tetraploidy within this species complex. We used chloroplast DNA haplotypes to examine phylogeographic structure between diploid and tetraploid species in this complex. In total, we generated 139 chloroplast DNA sequences representing 3-20 individuals per population for 22 populations representing the geographic range of these species in California. We identified 24 unique haplotypes. These data suggest a single origin of polyploidy for the 4x cytotype of P. heterophyllus and multiple origins of P. parvulus. Future studies using microsatellites will confirm whether the results seen for P. parvulus are truly the result of multiple polyploidy events or a result of chloroplast capture.
Poster #: 6
Project Title: Structure-Function Studies of Deinococcus radiodurans ADP Glucose Pyrophosphorylase: Probing the Role of Ser-48 in Allosteric Regulation
Author List:
Le-Pham, Ashley; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Mowery, Meg; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Ong, Leo; Graduate, Chemistry and Biochemistry, California State University, Fullerton
Meyer, Christopher; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Abstract: Adenosine Diphosphate Glucose Pyrophosphorylase (ADPGlc PPase) is an allosterically regulated enzyme that functions as the rate-limiting step of starch synthesis in plants and glycogen synthesis in bacteria. Because starch is a source of renewable and biodegradable carbon, ADPGlc PPase is an attractive target for protein engineering to increase biomass yield in crops. The microbial versions of this enzyme are quite diverse in their regulatory and physical properties; some of these properties would be useful to incorporate into transgenic crops to enhance starch production. Little is known about the enzyme from Deinococcus radiodurans (D. rad), an extremophile that is resistant to ionizing radiation and harsh growth conditions. When comparing the amino acid sequence of this enzyme to other characterized ADPG PPases, it was noted that position 48 differed with a serine substituted for alanine in a region known to be important for allostery. To probe the role of Ser-48, the S48A enzyme was generated by site-directed mutagenesis and the recombinant altered D. rad ADPGlc PPases successfully expressed in E. coli and purified via a scheme that includes anion exchange chromatography, size exclusion chromatography, and affinity chromatography. Initial studies on the S48A enzyme in the absence of activators have shown a dramatic 20-fold increase in the apparent affinity for the substrate ATP, a 3-fold increase for the cofactor magnesium, and a 4-fold increase in Vmax compared to wild-type (WT). There was no change in the apparent affinity for the substrate Glucose-1-P. Interestingly, in the presence of the activator FBP there was no change in the apparent binding affinity for substrates or Vmax compared to WT which displays a 5-fold increase in Vmax and 12-fold and 3-fold increase in apparent affinity for ATP and magnesium, respectively. The alanine substitution appears to result in an enzyme form that is partially activated but insensitive to activators. Complete kinetic analyses of the S48A enzyme as well as other N-terminus altered proteins are in progress. Supported in part by NSF Grant 0448676.
Poster #: 7
Project Title: Assessing Nitrate Reduction in a Woodchip Bioreactor for Pollutant Removal
Author List:
Martinez, Julio; Undergraduate, Science , California State University, Monterey Bay, Presenting Author
Haffa, Arlene; Faculty, Science, California State University, Monterey Bay
Abstract: The Salinas Valley is known as “the salad bowl of the word” for its productivity of lettuce, strawberries and other crops. This productivity is coupled to heavy use of pesticides, herbicides, and fertilizers. Current regulations require the agricultural industry to reduce pollution, and allows for this to be done using treatment systems. The purpose of this project was to test the efficiency of woodchip bioreactors to reduce nitrate to protect coastal habitats as well as reduce the environmental damage to marine waters that receive agricultural runoff. Water samples were collected at the inflow, middle flow and outflow of the bioreactor located at the Molera Road Treatment Wetland, near Castroville, CA. The samples were test for nitrate and phosphate concentration using low range nitrate Hach® test kit and Lachat QuickChem 8500. Results showed a high reduction of nitrates (96 %). Phosphate levels were inconsistent due to introduction of phosphate to the via the woodchips. This project will help highlight areas of improvement and management of future constructions of woodchip bioreactors. With future improvements and with best management implementation, woodchip bioreactors could be the control point source pollution from agriculture.
Poster #: 8
Project Title: Probing the Role of the C-termini of the Subunits of the Unique ADPGlucose Pyrophosphorylase from Thermotoga maritima
Author List:
Huang, Irene; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Vu, Crystal; Graduate, Chemistry and Biochemistry, California State University, Fullerton
Meyer, Christopher; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Abstract: ADPGlucose pyrophosphorylase (ADPG PPase) catalyzes the rate-limiting step of glycogen and starch biosynthesis in plants and bacteria, respectively. Structure-function studies of the enzyme from different sources will allow the engineering of a more active enzyme to produce more renewable and biodegradable carbon. In Thermotoga maritima (T.ma) there are two genes, glgC and glgD, which code for two subunits of this ADPG PPase. The recombinant N-terminal His-tagged subunits were successfully purified using a heat step and nickel chromatography. Previous studies performed at 37°C (pH 7.5) had shown that the wild type (WT) glgD alone had little to no activity, while the glgC protein displayed a specific activity of ~3 Units/mg with S0.5 values for ATP and magnesium (Mg) of 5.4 mM and 18.7 mM, respectively. However, the WT glgC/D complex at subsaturating substrate conditions was stimulated ~5-fold compared to glgC alone and was also activated ~2-fold by fructose bisphosphate (FBP). Previous alignment studies and molecular modeling indicated that the extreme C-terminus in glgC may play a role in catalysis and complex formation so the enzyme truncation at the C-terminal end at position G393 was generated to test this hypothesis. Evidence for the C-terminus of the glgD subunit playing a functional role includes the observation that an apparent proteolytic fragment of glgD is generated in a time dependent manner from the crude extract that activated glgC to a lesser extent than the full length glgD. To test this hypothesis, a glgD C-terminal truncated enzyme (ending at position G297) was generated in order to match the approximate size of the proteolytic fragment. The glgC truncation protein displayed a ~9 fold decrease in activity at subsaturationg substrate conditions in the presence and absence of FBP compared to WT glgC alone. Interestingly, the glgC truncation still displays a synergistic affect when in complex with WT glgD displaying ~5 fold increased activity at subsaturating concentrations. This suggests that this C-terminal end of the glgC subunit affects activity but does effect complex formation and subsequent stimulation of activity. Complete kinetic and physical characterization of the altered enzyme complex in the absence and presence of FBP is underway. The truncated glgD subunit has also been purified with characterization in the presence and absence of WT and truncated glgC in progress. Supported in part by NSF Grant 0448676.
Poster #: 9
Project Title: Isolation and Identification of Bioplastic Degrading Bacteria
Author List:
Holl, Steven; Undergraduate, Biological Sciences, California State University, Stanislaus
Brown, Aaron; Undergraduate, Biological Sciences, California State University, Stanislaus, Presenting Author
Shinn, Cheyanne; Undergraduate, Biological Sciences, California State University, Stanislaus, Presenting Author
Bola, Rajinder; Undergraduate, Biological Sciences, California State University, Chico
Sauer, Ryan; Undergraduate, Biological Sciences, California State University, Chico
Kuhn, Darryl; Undergraduate, Biological Sciences, California State University, Stanislaus
Vera, Hector; Undergraduate, Biological Sciences, California State University, Stanislaus
Hanne, Larry; Faculty, Biological Sciences, California State University, Chico
Kirk, Larry; Faculty, Biological Sciences, California State University, Chico
Thao, My Lo; Faculty, Biological Sciences, California State University, Stanislaus
Abstract: The vast amount of plastic accumulating in the environment is a major concern. Bioplastics are being marketed as a more viable alternative due to their potential for more rapid biological degradation. However, the rate of degradation in the environment may depend on whether the microorganisms responsible for the degradation are present in high numbers, otherwise the process may take many years. The goal of this study was to isolate and identify bacteria with the ability to degrade polyhydroxybutyrate (PHB), one type of bioplastic. Samples were obtained from various sites that we suspect to have higher populations of degraders. These samples were subjected to serial dilutions and plated on media containing PHB. Bacteria capable of utilizing PHB as a carbon source were detected by clearance around their growth on PHB plates, and were purified for further characterization. To identify the PHB-degrading isolates, we extracted total DNA and amplified the 16S rDNA by polymerase chain reaction (PCR) using primers 16SF-10: AAGAGTTTGATCATGGCTCA and 16SR-800: GACTACCAGGGTATCTAATCC. The 790 nucleotide PCR products were sequenced and the sequences were compared to the Genbank databases or ribosomal DNA databases for identification and classification. The following bacteria were identified: Pseudomonas alcaliphila, Microbacterium hominis, Pseudomonas nitroreducens and Pseudomonas citronellolis. We are currently carrying out induction studies. Preliminary data on induction specificity for the depolymerase will also be presented. The next stage of the project will be to characterize the degradative enzyme(s).
Poster #: 10
Project Title: Yeast ENV9 is a Conserved Oxidoreductase Involved in Lipid Droplet Biogenesis
Author List:
Mansoora Siddiqah, Ikha; Graduate, Biological Sciences, California State University, Long Beach, Presenting Author, Eden Award Finalist
Manandhar, Surya ; Postdoc, Biological Sciences, California State University, Long Beach
Gharakhanian, Editte; Faculty, Biological Sciences, California State University, Long Beach
Abstract: In eukaryotic cells, constant interactions between organelles and trafficking of cellular materials from one organelle to another are finely regulated to maintain cellular integrity. The complexity of such events is especially highlighted in the endomembrane system, which is comprised of the endoplasmic reticulum (ER), Golgi apparatus, late endosomes, lysosomes, lipid droplets, and plasma membrane. As endomembrane system regulation and trafficking are conserved between yeast and human, yeast serves as an ideal model for its study. ENV9 is a novel gene involved in vesicular trafficking in Saccharomyces cerevisiae. Previous characterization by our laboratory revealed that ENV9 deletion leads to defects in a lysosomal enzyme processing, increase in vesiculated vacuoles, and caffeine sensitivity. Our bioinformatic studies show that ENV9 is conserved among eukaryotes and exhibits similarity to human Retinol Dehydrogenase 12 (RDH12), whose product catalyzes reduction-oxidation reactions in retinoid visual cycle. Mutations of RDH12 have been linked to retinal dystrophy and Leber Congenital Amaurosis. Using microscopic and biochemical approaches, we show localization of Env9 to lipid droplets. Here we report that ENV9 plays a role in lipid droplet morphology by positively regulating lipid droplet expansion and lipid droplet fragmentation in response to carbon stress. Lastly, Env9 displays reductase activity towards sterol synthesis substrate 3-hydroxy-3-methylglutaryl-coenzyme A (HMG CoA) and toxic aldehyde 4-Hydroxynonenal (4-HNE). Point mutations in the conserved key residues in the active (N146L) and cofactor-binding sites (G23-24A) of Env9 abolish its reductase activity, as reported in other retinol dehydrogenases. Thus, we report a novel lipid droplet oxidoreductase involved in lipid droplet morphology. ENV9 may serve as a model to study lipid droplet expansion, interactions between organelles in endomembrane system, and genetic alterations correlated with retinal disease.
Poster #: 11
Project Title: Modeling, synthesis, and wet lab testing of lactase dehydrogenase inhibitors: hypothesis-driven undergraduate biochemistry lab experiences.
Author List:
Garcia, Victor; Undergraduate, Chemistry, California State University Channel Islands, Presenting Author
Tran, Catherine; Undergraduate, Chemistry, California State University Channel Islands, Presenting Author
Abstract: The characterization of Lactate Dehydrogenase (LDH), an enzyme that interconverts pyruvate and lactate, is a standard undergraduate biochemistry exercise. Our objective was to use molecular docking of LDH inhibitors as a hypothesis generator for this standard enzyme inhibition wet lab. Theoretical binding abilities of a series of inhibitors based on sodium oxamate were calculated. One of the model inhibitors, methyl oxamate, was not commercially available and had to be synthesized, purified, and confirmed through NMR spectroscopy before wet inhibition studies could begin. Preliminary assays showed that the methyl oxamate exhibited a 20% stronger inhibition than sodium oxamate, which supported the docking results. Changes in binding energy (DDG ~ -2 kcal/mol) seem proportional to incremental changes in the oxamate hydroxyl substituents, and these energies appear to correlate with the strength of the inhibitors.
Poster #: 12
Project Title: Characterization of Influenza Nucleoprotein body domain as antiviral target.
Author List:
Davis, Alicia; Graduate, Biology, California State University, San Bernardino, Presenting Author, Eden Award Finalist
Santana, Alan; Undergraduate, Biology, California State University, San Bernardino, Presenting Author
Newcomb, Laura; Faculty, Biology, California State University, San Bernardino
Abstract: Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by viral nucleoprotein (NP) and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins (vRNPs) responsible for RNA synthesis. NP is a critical structural component of the vRNP but also interacts with both viral and host factors to regulate viral RNA expression. NP is conserved among influenza A isolates, making NP interactions compelling antiviral targets.
Here we report characterization of NPbd3, an NP mutant encoding 5 amino acid changes within an accessible region of the NP body domain as determined by crystal structure. NPbd3 was designed to target interaction between NP and the RdRP, which is implicated in the switch from transcription to replication in vitro. We found NPbd3 was defective in RNA expression from both vRNA and cRNA templates as assessed by RT – qPCR.
To confirm NPbd3 defect was not due to NPbd3 mislocalization, we carried out cellular fractionation and found NPbd3 in nuclear and cytoplasmic fractions as WT-NP. However, the small molecule inhibitor nucleozin targets NP within this region and results in NP aggregation at the nuclear membrane. Therefore, we are attempting immunofluorescence and alternatively constructing plasmids to express NP-GFP fusion proteins to confirm NPbd3 localization within the cell. Based on NP crystal structure, NPbd3 is not expected to alter NP-RNA interaction and gel shift demonstrates NPbd3 shifts labeled ssDNA as WT-NP. Our initial evidence supports the defect in RNA expression in the presence of NPbd3 is not due to NPbd3 mislocalization or defect in RNA interaction. We hypothesize the defect is caused by a disrupted protein interaction.
To investigate the NP body domain further, single amino acid mutants were cloned. Analysis revealed that all were as functional as WT-NP. Our results suggest these accessible amino acids in the NP body domain play a redundant role, as no single mutation was responsible for the defect observed in NPbd3. Investigation of this NP domain will continue with double and triple mutants to identify which residues contribute to the defect observed. In addition, further biochemical analysis will be performed to examine NPbd3 vRNP formation and NPbd3 protein interactions. Our characterization of NP mutants within the accessible regions of the NP body domain will contribute to studies of antivirals targeting NP.
NIH SC3GM099559 to LN and MARC NIH T34GM083883 to AS.
Poster #: 13
Project Title: Role of glutathione in protection against environmental stress in cyanobacteria
Author List:
Abou-Naoum, Michelle ; Graduate, Biology, California State University, Fresno, Presenting Author
Brooks, Teresa; Staff, Biology, California State University, Fresno
Rajkarnikar Singh, Arishma; Postdoc, Biology, California State University, Fresno
Rawat, Mamta; Faculty, Biology, California State University, Fresno
Abstract: Glutathione (GSH), a major low molecular weight thiol in cyanobacteria, protects the cell from oxidative stress that is caused by reactive oxygen species produced as by-products of photosynthesis and aerobic respiration . GSH contributes to the reducing environment within the cell by acting as an electron donor, becoming oxidized to glutathione disulfide (GSSG) in the process. Biosynthesis of GSH is result of a two-step process involving two ATP-dependent enzymes: (1) γ-glutamylcysteine synthetase (GshA) and (2) glutathione synthetase (GshB). GSH levels are maintained within the cell through the action of glutathione reductase (Gor), which maintains a high ratio of GSH to GSSG by reducing glutathione disulfide (GSSG) back to GSH. While the functions of GSH are widely investigated in higher plants, not as much is known about the role of GSH in cyanobacteria, which are among the very few organisms that can perform oxygenic photosynthesis and respiration in the same compartment. To investigate the role of GSH and GSH dependent enzymes in protecting cyanobacteria from oxidative and other environmental stresses such as acidification, mutants disrupted in gshB and gor were created in the cyanobacterium Synechococcus PCC 7942, a model organism for studying stress adaptation in photosynthetic organisms. Growth of both mutants and the complemented strains was measured under a variety of oxidative and metal stress conditions . Thiol levels after treatment with the same stresses were determined. Interestingly, the gor mutant still contained substantial GSH. In addition, recombinant Gor was expressed in E. coli and the activity of the enzyme was assayed. Our results indicate that Synechococcus PCC 7942 Gor has similar values for Km and Vmax to the cyanobacterium, Anabaena sp. strain 7119. We are currently performing RNAseq to evaluate expression of genes in these mutants under disulfide stress in the form of the thiol oxidant diamide. Our long-term goal of this research is to understand the role of GSH in protecting cyanobacteria from environmental stress.
This research was supported by a National Science Foundation RUI Grant No. 1244611 to Dr. Mamta Rawat
Poster #: 14
Project Title: Quantification of Carbon Monoxide from a Photochemical Carbon Monoxide Releasing Molecule (PhotoCORM) using a Binuclear Rhodium(II) Compound
Author List:
Works, Carmen ; Faculty, Chemistry, Sonoma State University
Trevino, Kim; Undergraduate, Chemistry, Sonoma State University, Presenting Author
McCurry , Meghan; Undergraduate, Chemistry , Sonoma State University, Presenting Author
Abstract: Carbon monoxide is best known as a silent killer. However, it is also recognized as a small molecule signaling agent produced through heme catabolism which is catalyzed by heme oxygenase. There are two isozymes of heme oxygenase (HO) known as HO-1 and HO-2. HO-1 is an inducible enzyme in response to oxidative stress while HO-2 is expressed under homeostatic conditions, and both generate CO in vivo. Research has shown that CO plays a therapeutic role in the promotion of wound healing and reducing the risk of organ transplant rejection. Current therapeutic methods use direct inhalation of CO gas, which presents a risk of asphyxiation. Our research efforts are directed toward developing molecules that are capable of specific CO delivery to biological targets for both therapeutic use and toward elucidating the biological chemistry of CO. Photochemical carbon monoxide releasing molecules (PhotoCORMs) have the potential for achieving a safe and controlled delivery of CO to specific targets. Iron-Iron Hydrogenase model compounds show promise as potential PhotoCORMs. The generalized molecular structure of these compounds contains iron, sulfur and multiple C Os (μ-pdt-[Fe(CO)3]2) (1) and provides a platform for synthetic modifications, which allow chemical refinement for biological delivery. Current methods for the detection of CO from Photo and Thermal CORMs has been limited and problematic, so to help quantitate the photochemistry of CO release we are employing a binuclear rhodium(II) compound, [Rh2 {(C6H4)P(C6H5)2}2 (02CCH3)2] • (CH3CO2H)2 (2). Experiments use standard actinometry to determine the power of our light source and involve 365-nm irradiation of solutions of μ-pdt-[Fe(CO)3]2 and 2. Spectral changes in the optical spectra of both 1 and 2 are used to calculate CO produced per photon s absorbed (quantum yields). Quantum yield results are 0.084, 0.054, 0.052 for CO capture by 2 and 0.132, 0.152 and 0.156 for changes in concentration of 1.
Poster #: 15
Project Title: Purification and kinetic analysis of the Erythrobacter SD-21 manganese (II) oxidizing protein catalytic domain
Author List:
Dinh, David; Graduate, Biological Science, California State University, Fullerton, Presenting Author
Medina, Michael; Graduate, Biological Science, California State University, Fullerton
Johnson, Hope; Faculty, Biological Science, California State University, Fullerton
Abstract: Manganese (Mn) oxidizing microorganism play a predominant role in the oxidation and cycling of Mn in the environment. These organisms catalyze the oxidation of soluble Mn (II) to insoluble Mn (III/IV). In turn, these insoluble manganese oxides can be use in absorbing and oxidizing toxic chemical pollutants in the environment. An understanding of the enzymatic oxidation of Mn will provide insight into the geochemical cycling of Mn and novel bioremediation tools. Here, we present purification and kinetics analysis of the catalytic domain of the manganese oxidizing protein (Mop) from the α-proteobacterium Erythrobacter sp. SD-21. Large scale purification and concentration of the recombinant protein revealed additional bands on SDS-PAGE gels. Liquid chromatography – tandem mass spectrometry (LC-MS/MS) was conducted on a nickel affinity chromatography elution fraction and 14 excised SDS-PAGE gel bands to identify whether bands are contaminants or degradation products. Analysis of the results revealed that although most SDS-PAGE bands contained peptides from the target protein, there were also proteins of the host organism, Escherichia coli. The potential effects these proteins have on manganese oxidation are presented. In addition, a preliminary kinetic study was conducted to determine the Michaelis constant (Km) and maximum velocity (Vmax) of Mn oxidation. Determining the enzymatic mechanism and activity will provide a greater understanding of the capability of this enzyme in bioremediation. Further research will focus on optimizing the purification of the enzyme and further enzyme kinetics.
Acknowledgement: Special thanks to Sophie Alvarez and Mike Naldrett of Donald Danforth Plant Science Center, Proteomics and Mass Spectrometry Facility, the National Science Foundation, and CSUPERB.
Poster #: 16
Project Title: Increasing the production of a beetle antifreeze protein in E. coli by minimizing the incubation time after induction
Author List:
Enriquez, Ernest; Undergraduate, chemistry and biochemistry, California State University, Los Angeles, Presenting Author
Truong, Huy; Undergraduate, chemistry and biochemistry, California State University, Los Angeles
Bagdagulyan , Yelena; Undergraduate, biological sciences, California State University, Los Angeles
Wen, Xin ; Faculty, chemistry and biochemistry, California State University, Los Angeles
Abstract: The expression of heterologous proteins in Escherichia coli (E. coli) is a common way for recombinant protein production. The optimal expression depends on many parameters and is complex. Extensive efforts have been made to optimize these parameters with various proteins from different organisms in order to obtain maximum expression levels and thus the highest yield of production. In this study, we investigated the effect of duration of induction time on the expression level of a beetle antifreeze protein from Dendroides canadensis (DAFP-1) in E. coli cells. We performed a time course study and analyzed the expression of recombinant DAFP-1 using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). We then purified the protein using affinity and ion exchange chromatography and and determined the yields of the protein. We determined the minimum incubation time after induction that is needed for maximum expression levels and significantly increased the expression levels and yields of DAFP-1 by about two fold.
Acknowledgements
We thank Dr. John Duman at University of Notre Dame for providing the cDNA of DAFP-1 and National Institutes of Health Grant GM086249 for supporting the study. We thank the members in Wen lab for their helps.
Poster #: 17
Project Title: Identification of Mycobacterium smegmatis genes associated with antibiotic resistance and oxidative stress using transposon mutagenesis
Author List:
Ramlan Hussain, Alisha; Undergraduate, Biology, California State University, Fresno, Presenting Author
Ghebrendrias, Natsinet; Undergraduate, Biology, California State University, Fresno
Aleru, Shola; Undergraduate, Biology, California State University, Fresno
Rawat, Mamta; Faculty, Biology, California State University, Fresno
Abstract: Transposon mutagenesis is a powerful technique for the investigation of gene and protein function and cellular processes. By generating insertional mutants and then screening the mutants for a specific phenotype, insight into various processes and gene function can be obtained. Over the years, we have created a transposon mutant library of over 16 000 Mycobacterium smegmatis mutants using the Ez::Tn transposase system . Mycobacterium smegmatis is a non-pathogenic model organism for the study of Mycobacterium tuberculosis, a bacterium that causes tuberculosis. Although anti-tuberculosis therapy exist, strains that are resistant to a number of drugs used to treat this disease are becoming more common. One use of the transposon mutant library is to screen for mutants that are resistant to isoniazid and ethionamide, two common drugs used in antibiotic therapy, in order to find out how resistance to these drugs occurs. This screen identified a number of mutants disrupted in already known genes, mshA and mshC associated with mycothiol biosynthesis, and ethR, associated with ethionamide resistance. A number of mutants disrupted in conserved proteins were also identified. A second use of the transposon mutant library is to screen for mutants sensitive to oxidative stress. All organisms are exposed to oxidative stress caused by reactive oxygen species released intracellularly during metabolic processes, such as aerobic respiration, and thus have numerous mechanisms to protect themselves against oxidative stress. Pathogens like M. tuberculosis must also deal with the human immune cells, phagosomes, which release these reactive species as a form of defense against pathogens. All cells use low molecular weight thiols to maintain the redox balance within the cell and thus disulfide stress is a subset of oxidative stress. A screen for mutants sensitive to diamide, a thiol oxidant, revealed over 200 genes disrupted in oxidative stress defense, fatty acid biosynthesis/degradation, and protein/nucleic acid turnover and biosynthesis. The disrupted genes were identified through inverse PCR and direct sequencing of the PCR product. We have thus made progress in identifying genes that are critical for protection against disulfide stress.
This work was funded by College of Science and Mathematics Faculty Sponsored Student Research Awards and the Dean of Undergraduate Studies Undergraduate Research Awards to Alisha Ramlan Hussain and Natsinet Ghebrendrias.
Poster #: 18
Project Title: Studies of enoyl-ACP reductase inhibition by novel diazaborines for the design of new antibiotics
Author List:
Sandoval, Braddock; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Jordan, Cheryl; Eisenhower Medical Center
Serobyan, Mkrtich; Undergraduate, Biology, California State University, Northridge
Karim, Hawra; Graduate, Biological Sciences, California State University, Los Angeles
Wong, Casper; Graduate, Chemistry and Biochemistry, California State University, Northridge
Groziak, Michael; Faculty, Chemistry and Biochemistry, California State University, East Bay
Xu, Hao Howard; Faculty, Biological Sciences, California State University, Los Angeles
Vey, Jessica; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Multidrug resistant Acinetobacter baumannii, a Gram-negative opportunistic pathogen, has become a serious cause for concern in military and civilian hospitals around the world, due to increasing reports of nosocomial infections. Current strategies to curb infection rely mainly on prevention, and the use of last resort polymyxin antimicrobials, which are known to cause nerve and kidney damage. A potentially nontoxic strategy for eliminating A. baumanni lies in the disruption of the bacterial fatty acid biosynthetic pathway via the inhibition of enoyl acyl carrier protein reductase (ENR). Successful ENR inhibitors such as triclosan have become widespread in commercial and industrial applications; however, this has led to increased apprehension about resistance development. For these reasons we are characterizing the inhibition of E. coli and A. baumanii ENR by four new diazaborine molecules and investigating the differences in specificity between these potential inhibitors. To quantitate the inhibitory action of these molecules, we use a spectrophotometric assay that directly monitors the enzymatic consumption of the cosubstrate NADH. Here we report two high-resolution crystal structures of E. coli ENR bound to two of our diazaborine molecules along with kinetic studies investigating ENR inhibition by all four diazaborines. We also present our progress towards expression and purification of A. baumannii ENR, the structure of which is currently unsolved. Our next goals include structural characterization of A. baumannii ENR, which will reveal the active site architecture of that enzyme. Taken together, these studies will help us (1) determine whether these new diazaborine inhibitors have potential as therapeutics, and (2) understand differences and similarities in the ENR enzyme active sites that may be exploited for the development of new narrow spectrum antibiotics. Funding for this project was provided by the CSUN Chemistry and Biochemistry Department (JLV), a grant (W911NF-12-1-059) from the Army Research Office (HHX) and by the CSULA LSAMP-BD program which is supported by NSF (grant No. HRD-0802628) and the CSU Office of the Chancellor (HHX).
Poster #: 19
Project Title: Investigation into the Chemical Interactions of Biologically Relevant Persulfide Species
Author List:
Henriquez, Stephanie; Undergraduate, Biology, Sonoma State University, Presenting Author
Sosa, Victor; Undergraduate, Chemistry, Sonoma State University, Presenting Author
Saund, Simran; Staff, Chemistry, Sonoma State University
Ono, Katsuhiko; Postdoc, Chemistry, Sonoma State University
Lin, Joseph; Faculty, Biology, Sonoma State University
Fukuto, Jon; Faculty, Chemistry, Sonoma State University
Abstract: Hydrogen Sulfide (H2S) is an endogenously generated small molecule signaling agent with an impressive array of reported biological activity. It has previously been proposed that H2S itself is the species directly responsible for the related physiological effects, however, recent work from this lab and others indicates that persulfides (RSSH) may be the important effector species. Indeed it is now proposed that the detection of H2S in biological systems may act more as a marker for the presence of persulfide activity within that cell. In order to illuminate the more specific mechanisms through which persulfides act, an investigation into the chemistry was carried out. The data presented herein provides insight towards elucidating the fundamental chemical properties associated with persulfides. Specifically, the reaction of persulfides with O2, H2O2 and the mechanisms of their spontaneous degradation have been examined. It is found that persulfides can react with O2 and H2O2 more quickly than the corresponding thiol species. Also, it is found that persulfide decomposition is highly pH-dependent, consistent with the proposed chemical properties of the acid-base equilibrium species. In addition, we have examined the effects these species have on redox regulated enzymes, using the phosphatase CD148 as a model system. Thus far, it has become clear that the nucleophilic and reductive chemistry of persulfides allows them to serve as “hyperactivated” forms of thiols and that this may be important to their biological utility and function.
Poster #: 20
Project Title: Persulfide Formation Protects Cysteine Thiols Against Damaging Modifications
Author List:
White, Corey; Undergraduate, Chemistry, Sonoma State University, Presenting Author
Millikin, Robert; Undergraduate, Chemistry, Sonoma State University, Presenting Author
Henriquez, Stephanie; Undergraduate, Biology, Sonoma State University
Saund, Simran; Staff, Chemistry, Sonoma State University
Ono, Katsuhiko ; Postdoc, Chemistry, Sonoma State University
Lin, Joseph; Faculty, Biology, Sonoma State University
Fukuto, Jon; Faculty, Chemistry, Sonoma State University
Abstract: Catalytic cysteine residues play a critical role in a diverse array of enzymatic functions, including metabolic and cell signaling pathways. Since these enzymes typically require a reduced cysteine thiolate (RS-) to maintain enzymatic activity, they are particularly vulnerable to inactivation by covalent modification. Overoxidation or alkylation of cysteine residues can lead to irreversible loss of enzyme activity. An emerging field in biochemistry is the study of the role of endogenously generated persulfide (RSSH) species. Recent publications have shown that persulfides are present in nanomolar to micromolar concentrations within human plasma and mouse tissues, including murine brain, liver and heart; however, their physiological role is unknown. Previous work has demonstrated that persulfides react with oxidants and electrophiles faster than a typical thiol. These studies underline their potential to serve as physiologically important antioxidants. In this study, we present data supporting an additional mechanism by which persulfide generation on a thiol may protect it against oxidants and electrophiles. Persulfide formation on recombinant CD148, a thiol phosphatase, was achieved by incubation of CD148 with 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB) followed by incubation with sodium sulfide (Na2S). Persulfide-modified CD148 activity was significantly higher when compared with the non-modified CD148 after exposure to either oxidizing or alkylating conditions and subsequent exposure to dithiothreitol (DTT). We show that these persulfide adducts are readily reduced by DTT, regenerating the original thiol species. Additionally, we have characterized these mechanisms using glutathione as a model. These experiments provide much-needed insight regarding the protective role of persulfide species, and have laid the groundwork for further investigation.
Poster #: 21
Project Title: Copper components of milk secreted by human mammary epithelial cells (PMC42) in response to lactational hormones
Author List:
Nguyen, Tiffany; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Maki, Mostafa; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Linder, Maria C.; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Abstract: During mammalian development, most of the iron to be used by the newborn for growth in the first part of life (during lactation) is transferred from the mother to the placenta and fetal liver before birth, and little is provided in the milk. Some Cu is also stored this way during gestation, but a great deal is actually provided the infant via milk. Despite the importance of this trace element for the infant, little is known about the forms in which Cu is present in milk. Some time ago, we determined and reported that in human, pig and rat milk about 25% is bound to the alpha2-globulin, ceruloplasmin (Cp), which is also the main Cu binding protein in blood plasma. Moreover, milk Cp is synthesized by the mammary epithelial cells themselves.
As a means to discover what other forms of Cu might be secreted into milk, we used a cell culture model of mammary epithelium that has been demonstrated to produce milk proteins when in the form of a polarized monolayer with tight junctions, grown in bicameral chambers, and pretreated with a regimen of lactational hormones. Radioactive copper (64Cu or 67Cu2+) was administered to the basal (blood) side of the monolayer, and secretions were collected on the apical side from 1.5 to 48h later, concentrated by ultrafiltration and separated in size exclusion FPLC (SEC) for further analysis. Total radioactivity in cells and secretions was also measured.
Uptake of the radioactive copper (administered as 5 uM Cu-nitrilotriacetate by the monolayers from the basal side increased from about 20% by 3h to about 50% by 24h, and the percentage released into apical secretions was about 40% by 24h. Cp was confirmed to be present by Western blotting. When secretions were separated by SEC, three radiolabeled components were observed, ranging in size from >200 kDa (nature unknown), to Cp (about 130 kDa) to Our results suggest that apart from Cu contained in Cp, at least two other components, one of which is a larger protein the other very small, account for most of the Cu in milk, and we expect their nature to be revealed in the near future by mass spectrometric analysis.
Poster #: 22
Project Title: Photolysis of Caged Dioxygen in Low-Temperature Magnetic Circular Dichroism (MCD) Studies of Hemoglobin
Author List:
Cada, Abraham King; Graduate, Chemistry & Biochemistry, San Francisco State University, Presenting Author
Baptista, Diego ; Graduate, Chemistry & Biochemistry, San Francisco State University
Esquerra, Raymond; Faculty, Chemistry & Biochemistry, San Francisco State University
Abstract: Clarifying enzymatic reaction mechanisms is essential to provide insights into the fundamental biochemistry but also toward designing strategies that can inhibit or enhance enzyme function. Despite the recent advances in utilizing low-temperature conditions in capturing transient reaction intermediates, fundamental control of initiation and proper monitor of catalytic reactions remains a challenge. This study demonstrates the feasibility of photoinitiating oxygen dependent reactions using a cobalt complex, (μ-peroxo)(μ-hydroxo)bis[bis(bipyridyl)cobalt(III)]nitrate (HPBC). We show the release of dioxygen by HPPC with ultraviolet light at ambient and cryotemperatures. Deoxyhemoglobin and the formation of oxyhemoglobin upon irradiation of the complex will be monitored using UV/Vis spectroscopy and magnetic circular dichroism (MCD) spectroscopy. Verification of the viability of HPBC in delivering dioxygen in situ under cryotemperatures combined with temperature-controlled spectroscopy can be used in studying fast reaction mechanisms that involve molecular oxygen.
Poster #: 23
Project Title: Stability and Protease Resistance of Camel Nanobodies for the Development of Oral Therapeutics
Author List:
Bautch, Samariah; Undergraduate, Chemistry, California State University, Fresno, Presenting Author
Toride, Moeko; Graduate, Chemistry, California State University, Fresno, Presenting Author
Brooks, Cory L.; Faculty, Chemistry, California State University, Fresno
Abstract: An illness affecting approximately 1600 people per year, the effects of Listeriosis can be devastating. According to the CDC, it results in 260 deaths annually in the United States. Due to its ability to cross the placental barrier, it is especially harmful when it infects pregnant women and their unborn child. This study aims to develop oral therapeutics that can target the disease. The immune systems of camels, alpacas and llamas produce a unique heavy chain only antibody. By cloning the variable region of these antibodies, the smallest known antigen-binding fragment, the nanobody, is produced. The unique binding sites of nanobodies have the ability to bind epitopes typically unavailable to traditional antibodies such as cavities on protein surfaces. In addition, they have unusually high affinity and stability. We have isolated five nanobodies that potentially inhibit Listeria colonization of cells, and present the potential for a new type of Listeria therapeutic. To develop effective pharmaceuticals that block Listeria infection, understanding the stability of the nanobodies in the conditions of the human body would be highly beneficial. To this end, we are examining the resistance of the nanobodies to the digestive proteases trypsin, chymotrypsin and pepsin using gel shift assays. We are also investigating the stability of the nanobodies using differential scanning calorimetry. The results obtained from this study will guide future development of these nanobodies as oral therapeutics for treatment of Listeria.
Poster #: 24
Project Title: Expanding the Light-Driven Hybrid P450 Enzyme Approach to P450cam from Pseudomonas putida
Author List:
Lam, Quan; Undergraduate, Chemistry, San José State University, Presenting Author
Tang, Lawrence; Undergraduate, Chemistry, San José State University, Presenting Author
Banh, Tam; Undergraduate, Chemistry, San José State University
Nguyen, Thanh Truc; Undergraduate, Chemistry, San José State University
Bhandarkar, Meghana; Staff, Chemistry, San José State University
Kato, Mallory; Staff, Chemistry, San José State University
Cheruzel, Lionel; Faculty, Chemistry, San José State University
Abstract: The selective oxidation of unactivated C-H bonds performed by cytochrome P450 enzymes has rendered them of high interest for biotechnological and synthetic applications. To catalyze their reactions, these heme-thiolate enzymes utilize molecular dioxygen as the source of the oxygen atom and two reducing equivalents delivered to the heme domain from NAD(P)H by the electron carrier, reductase. Our laboratory has developed an approach to drive P450 reactions upon visible light irradiation using P450 BM3 heme domain hybrid enzymes containing a covalently attached Ru(II)-diimine photosensitizer. We recently reported high photocatalytic activity achieved through the attachment of the photosensitizer at a non-native cysteine residue while the need for the redox partner and NAD(P)H cofactor is circumvented.
To test the applicability of our light-driven system for other P450 enzymes, we have expanded our methodology to another soluble P450, P450cam from Psuedomonas putida. Using site-directed mutagenesis we have generated a library of P450cam mutants that incorporate a non-native cysteine residue for the covalent attachment of the photosensitizer and create structural changes that mimic the conformational changes due to reductase binding. The mutant genes were sequenced to confirm the desired coding sequence. The mutant P450cam enzymes were then expressed in Escherichia coli, purified by ion exchange and size exclusion chromatography, and subsequently labeled with the photosensitizer. The resulting hybrid enzymes were characterized by mass spectrometry and CO binding studies. Our results for the hydroxylation of camphor evaluated using gas chromatography-mass spectrometry and the colorimetric m-nitroacetophenone assay indicate our light-driven methodology can be expanded to other members of the cytochrome P450 family.
Poster #: 25
Project Title: Killing Efficacy of the VIA Wild-Type via Fluorescent Analysis
Author List:
Gutierrez, Josh; Undergraduate, Chemistry, Sonoma State University, Presenting Author
Lillig, Jennifer; Faculty, Chemistry, Sonoma State University
Abstract: Background:
Small peptide bacteriocins produced by gram positive bacteria are known to have antimicrobial properties against lactic acid producing bacteria, including Listeria monocytogenes- a pathogen found in food products. The following study seeks to elucidate the killing efficacy of piscicocin V1a, a class IIa bacteriocin, from Carnobacterium piscicola. Thereby, proving piscicocin V1a kills rather than acting as a bacteriostat- a chemical that stops bacteria from reproducing without necessarily harming them. Determination of live and dead bacteria were differentiated using a LIVE/DEAD® BacLight Bacterial Viability Kit, which stains dead cells red and viable cells green.
Methods:
The peptides were purchased in pure form from AnaSpec (San Jose, CA). All bactericidal killing assays were performed by growing Listeria overnight in Tryptic Soy Broth (TSB). Upon the following day, 1E7 cfu/ml bacterial suspensions were then introduced into a 96-well plate with serial dilutions of the V1a peptide. A LIVE/DEAD® BacLight Bacterial Viability Kit was purchased from Life Technologies, and was implemented in the following experiment. Staining of the bacteria were quantified using a Biotek Gen5 microplate reader. Excitation was centered at 485nm and emission intensity was monitored at 528nm (alive) & 590nm (dead).
Results:
The V1a peptide was tested against Listeria Monocytogenes at a 125nM concentration. Results showed that there was a 55% reduction in bacterial viability at this concentration which was well above the IC50 value of the V1a peptide determined in our lab by other studies (2.6 nM). However, additional controls and precaution must be taken in account due to varying bacterial viability as a function of VIa peptide concentration.
Conclusion:
The V1a peptide demonstrated killing efficacy based on the greater ratio of red to green in treatment groups. A concentration of 125nM of the VIa exhibited 55% reduction in bacterial viability. Future goals will be to statistically confirm these results and to test mutant forms of the peptide.
Acknowledgement:
This project was funded by CSUPERB Seed and Faculty Development grants, a Research Corporation CCSA award, LSAMP, and Sonoma State University’s McNair Program.
Poster #: 26
Project Title: Catechol-O-methyltransferase modulates anti-cancer activity of anthocyanins
Author List:
Grimes, Karnell; Undergraduate, Chemistry and Biochemistry, California State University, Bakersfield, Presenting Author
Forester, Sarah; Faculty, Chemistry and Biochemistry, California State University, Bakersfield
Abstract: According to the American Cancer Society, colon cancer is the third most common type of cancer in the United States for both men and women. Consumption of a healthy diet, including fruits and vegetables, may help prevent this disease. Anthocyanins are a class of polyphenols that contribute to the color of foods such as strawberries, blueberries, and grapes. These compounds have been shown to reduce the incidence of colon cancer, yet they are heavily metabolized in the body, limiting their anti-cancer activities. Specifically, anthocyanins are methylated by catechol-O-methyltransferase (COMT), transforming them into potentially less bioactive compounds. The anti-cancer effects of anthocyanins compared to their methylated metabolites remains to be fully understood. We compared the anti-proliferative activity of a rubired grape anthocyanin extract with its methylated metabolites in human colon cancer cell lines. The anti-proliferative effects of pure anthocyanin compounds, cyanidin-3-glucoside and delfinidin-3-glucoside were also compared to their methylated metabolites. The effect of entacapone on increasing the bioactivity of polyphenols may be due to inhibition of COMT, but also by increasing the extracellular production of ROS (reactive oxygen species). Using the fox assay, we studied the levels of ROS in cell culture media treated with methylated or non-methylated anthocyanins. In conclusion, COMT catalyzed methylation could potentially weaken the anti-cancer activities of anthocyanins. These findings suggest that an understanding of how commonly consumed food components are metabolized is important for cancer prevention.
Poster #: 27
Project Title: Ultrasensitive Detection and Separation of Cancer Antigen CA 15-3 and Proteins by Nonlinear Laser Wave-Mixing Spectroscopy and Capillary Electrophores
Author List:
Ramos, Sashary; Undergraduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Hetu, Marcel; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Iwabuchi, Manna; Graduate, Chemistry and Biochemistry, San Diego State University
Tong, William; Faculty, Chemistry and Biochemistry, San Diego State University
Abstract: Novel nonlinear laser wave-mixing spectroscopy is presented as a highly sensitive absorption-based detection method for biomedical applications. Wave mixing offers inherent advantages including excellent sensitivity, small sample requirements, short optical path length, high spatial resolution and excellent standoff detection capability. The sensitivity level provided by laser wave mixing is ideal for the detection of specific prognostic markers and proteins, such as carcinoma antigen 15-3 (CA 15-3), the most commonly used serum marker for breast cancer and select protein ladders. The CA 15-3 marker is also associated with epithelial ovarian cancer and lung cancer. Sensitive detection of CA 15-3 will greatly improve breast cancer monitoring as well as the diagnosis of recurring breast cancer, and potentially achieve earlier detection of breast cancer. In a typical wave-mixing setup, the signal is generated when the two input beams intersect on the capillary containing the analyte of interest. The wave-mixing signal is a coherent laser-like beam and can be collected with virtually 100% efficiency and minimal background noise. The signal has a cubic dependence on laser power and a quadratic dependence on analyte concentration, and hence, it is inherently suitable as a chemical sensor (big signal changes for small chemical changes). A 473 nm laser is used in our setup to detect CA 15-3 labeled with NBD-X, a fluorescent dye, as well as a protein ladder for identification purposes.
Acknowledgments: NIH R01, NSF, U.S. Army, U.S. DHS, NIH IMSD Grant #5R25GM058906-12
Poster #: 28
Project Title: The Effects of BMAA and L-Glutamic Acid on Locomotion, Learning, and Short-Term Memory in Drosophila melanogaster
Author List:
Zoghi, Shayan; Undergraduate, Chemistry, California State University, Fresno, Presenting Author
Goto, Joy J.; Faculty, Chemistry, California State University, Fresno
Abstract: Age-matched virgin female flies (groups of 10 each) were collected and fed BMAA or L-Glutamate (12.5 mM) for three days in a 22 degree Celsius and light maintained (12h dark: 12h light) incubator. The locomotor ability was independently tested and measured for each fly using the simple tap-down method. A traditional T-maze apparatus to test learning and memory of flies was used. The flies were trained to associate the light chamber with the odor depressant within 10 conditioning trials. The short-term memory of flies was then measured after 6 hours of the initial training. Data analysis was applied using a Chi-Square test for analysis.
The results from the experiment indicate ingested BMAA can impact the fly locomotor, learning and short-term memory functions. On days 1, 2, and 3, the control flies had a 93, 96, and 84% success rate, 12.5 mM L-Glutamate had a 84, 80, and 79% success rate, and 12.5 mM BMAA had a 67, 31 and 24% success rate of climbing past the 8-cm mark in 10 seconds. The control flies had a 75, 77, and 74% success rate, 12.5 mM L-Glutamate had a 65, 62, and 49% success rate, and 12.5 mM BMAA had a 57, 20, and 13% success rate of associating the light source with the quinine depressant and thus remaining in the dark chamber during the allotted time. After 6 hours from the initial training, control flies that previously showed learning success still had a 96, 88, and 86% success rate, 12.5 mM L-Glutamate had an 81, 77, and 57% success rate, and 12.5 mM BMAA had a 45, 13, and 15% success rate of remembering the detrimental effects of quinine-moistened filtered paper. These results indicate that flies treated with BMAA show a similar pattern of cognitive learning and memory deficits, similar to that of humans exposed to neurotoxic levels of BMAA.
This project was supported by:
CSUPERB 2013 Presidents’ Commission Scholars Program
CSU Fresno Division of Undergraduate Studies 2013-14 and 2014-15 Research Award
Poster #: 29
Project Title: Site directed mutagenesis, biochemical and crystallographic studies on Dibenzothiophene monooxygenase (DszC).
Author List:
Gonzalez-Osorio, Liliana; Graduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Luong, Kelvin; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Iskandaryan, Zarui; Undergraduate, Chemistry and Biochemistry, California State University, Northridge
Vey, Jessica; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Sulfur dioxide production in the combustion of fossil fuels is a serious contributor of atmospheric pollution. Biodesulfurization (BDS) pathways from certain bacterial species provide an efficient alternative to hydrodesulfurization for the removal of sulfur in crude oils. However, improvements to BDS pathways are needed to effectively generate low-sulfur fuels at the industrial level. Our ultimate goal is to rationally design the Rhodococcus erythropolis biodesulfurization pathway, reducing substrate specificity of the component enzymes to allow for desulfurization of a wider array of organic sulfur compounds. Here we investigate the initiating enzyme of this pathway, dibenzothiophene (DBT) monooxygenase (DszC), in hopes of improving its rate and substrate tolerance. DszC is a class D flavin monooxygenase that oxidizes DBT to DBT-sulfone. To study DszC’s catalytic mechanism, we will generate active site mutants and investigate their effects on enzyme activity, nonproductive peroxide elimination and flavin binding. Our first four mutants are H92A, S163A, H391A, and V261F. Each mutant should negatively impact catalysis or alter substrate discrimination. Our four mutants were each generated by mutagenic PCR, subjected to expression trials in E. coli BL21 (DE3) cells and purified by affinity chromatography. Enzymatic activity was measured by following substrate consumption with high-performance liquid chromatography and spectrophotometric detection at 285nm. The dependence of the catalytic rate on temperature, pH, and substrate concentration was determined for wild type DszC and will be compared with those of the mutants. Crystallization experiments were carried out with wild type DszC and the V261F mutant. Crystal formation was observed in three different conditions, all of which will be optimized for use in the structural characterization of V261F-DszC and wild-type DszC in complex with flavin and substrate. This poster will present progress we have made towards characterizing the DszC catalytic mechanism and kinetics.
This work was funded by a Cottrell College Science Award from the Research Corporation and the CSUN Department of Chemistry and Biochemistry.
Poster #: 30
Project Title: Evaluating the role of glycine metabolism in Breast Cancer
Author List:
Bhavnani, Neha; Graduate, Biotechnology, California State University, Fresno, Presenting Author
Bush, Jason; Faculty, Biology, California State University, Fresno
Abstract: Cancer cells require a readily available pool of amino acids to synthesize new proteins to rapid multiply and grow. There is strong evidence that the non-essential amino acid, glycine is critical to cancer cell proliferation. The pathway via which this mechanism occurs is still not well understood in different types of breast cancer and may vary depending on their estrogen receptor (ER) status. Our goal in this study is to investigate the correlation between glycine synthesis and the estrogen receptor status of breast cancer cells. In this study, we evaluated the effect of different concentrations of extracellular glycine (0 mM, 0.4 mM & 4 mM) on a breast epithelial model system with the breast cancer cell lines MCF-7 (ER+), MDA-MB-231 (ER-), and MCF-10A (a normal mammary epithelial cell line) to differentiate the effect of glycine on tumorigenic and non-tumorigenic cells. After 72-hour incubation, an inhibitory effect was observed with high concentrations of glycine in tumorigenic cells, while a proliferative effect was observed in normal breast epithelial cells. Using semi-quantitative RT-PCR to quantify gene expression, significant changes were observed in four major genes involved in the glycine synthesis pathway depending on the cellular compartment. Mitochondrial genes, Serine hydroxymethyltransferase 2 (SHMT2) and Methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) that showed elevated expression versus cytoplasmic genes, MTHFD1 and SHMT1, that showed reduced expression. Furthermore, this appeared consistent with NMR results of whole cell extracts from the same samples. Taken together, these results suggest that glycine metabolism may be a promising therapeutic target in breast cancer and possibly other types of cancer.
Poster #: 31
Project Title: Bcl-2 and Bcl-xL overexpression have opposite effects on fermentative and oxidative components of carbohydrate metabolism
Author List:
Wilson, Jessica; Undergraduate, Biology, California State University, Fresno, Presenting Author
Ahmad, Miriam; Undergraduate, Chemistry, California State University, Fresno
Olino, Patricia; Undergraduate, Nursing, California State University, Fresno
Mahmood, Bushra; Graduate, Chemistry, California State University, Fresno
Dejean, Laurent; Faculty, Chemistry, California State University, Fresno
Abstract: Apoptosis is a mode of programmed cell death which occurs in response to physiological or pathophysiological stimuli. This signaling of apoptosis is highly regulated by Bcl-2 family proteins which can be found either in the cytoplasm, or loosely bound to mitochondrial membranes of the cell. Two proteins of this family, i.e. Bcl-2 and Bcl-xL, are known inhibitors of apoptosis. Over-expression of these proteins is often associated with blood cancers such as non-Hodgekin’s lymphoma. Certain cancer cells often exhibit a shift in metabolism characterized by the theory known as the Warburg Effect, where glycolysis is increased along with lactic fermentation. This study investigates the metabolic consequences of over-expression of Bcl-2 or Bcl-xL in pro-lymphocytic B cells (FL5.12 cell line). The specific activities of an enzyme marker of oxidative metabolism (Citrate Synthase, CS), and of an enzyme marker of lactic fermentation (Lactate dehydrogenase, LDH) were specifically measured to identify a possible shift in metabolic allocation as a direct result of the over-expression of one of these anti-apoptotic proteins. The specific activity of the enzyme Glyceraldehyde 3-Phosphate dehydrogenase (G3PdH) was used to standardize both CS and LDH activities. The cell lines were cultured separately in Iscove’s DMEM suspension, subjected to whole cell protein extraction using a lysis buffer containing Triton X-100, and the specific enzyme activities of LDH, CS, and G3PdH were measured using spectrophotometry. Interestingly, both LDH and CS activities were differentially regulated by Bcl-2 and Bcl-xL. Bcl-2 overexpression induced a significant increase of the LDH/G3PdH ratio and no change of the CS/G3PdH ratio; when Bcl-xL overexpression induced a significant increase of the CS/G3PdH ratio and a significant decrease of the LDH/G3PdH ratio vs. Parental. Taken together, these results suggest that Bcl-2 overexpression may trigger a metabolic shift towards lactic fermentation; when Bcl-xL overexpression would tend to more stimulate the oxidative component of carbohydrate metabolism. Experiments of respirometry are currently underway to directly assess these hypotheses by determining the effect of Bcl-2 or Bcl-xL overexpression on the mitochondrial oxidative phosphorylation capacity of FL5.12 cells.
Poster #: 32
Project Title: Evaluation of Pesticide Involvement in Breast Cancer
Author List:
Patterson, Kathryn ; Graduate, Biology, California State University, Fresno, Presenting Author
Bush, Jason; Faculty, Biology, California State University, Fresno
Abstract: There is considerable evidence linking cumulative and sustained exposure to estrogens as a key promoter of breast tumor proliferation. Chemicals with estrogenic activity can bind to the estrogen receptor (ER) to affect downstream signaling of estrogen-responsive genes. Organochlorines are a class of chemical pesticides that can act as xenoestrogens to disrupt normal endocrine function. Mitochondria play a significant role in maintenance of energy regulation and cellular detoxification and mitochondrial DNA is sensitive to levels of estrogen. Some members of the Estrogen Related Receptor (ERR) family are known to interact with hypoxia inducible factors to modulate mitochondrial response through the mTOR pathway which is pivotal to cell homeostasis and cellular detoxification. This study investigates the link between two organochlorine pesticides, Methoxychlor and Toxaphene, and the cellular effects by examining the hypothesis that exposure induces differential molecular pathways. Two breast cancer cell lines, MCF-7 (ER+) and MDA-MB-231 (ER-), and a normal breast epithelial cell line MCF-10A are used as a model to evaluate the response to Methoxychlor and Toxaphene treatment. Cytotoxicity studies established different sensitivities of the two breast cancer cell lines to pesticides. MCF-7 was more sensitive to both pesticides, which supports the premise that organochlorines may be acting as endocrine disruptors. Furthermore, pesticide-resistant clones of MCF-7 and MDA-MB-231 were established and compared to their sensitive counterparts. RNA was collected from cells treated in a hypoxic environment, cells treated with a high dose pesticide, and cells that had a co-treatment of hypoxia and pesticide for evaluation of ERR, hypoxic factor expression, and markers of mTOR pathway. Flow cytometry, RT-PCR and immunoblotting demonstrated that treatment affected mitosis and mitochondrial function and we found that ERR and hypoxic factor expression changed in a similar manner suggesting a common mechanism by pesticide treatment or hypoxic conditions. These results provide a basis for understanding specific pesticide-induced molecular mechanisms and their possible relationship to ER+ and ER- mammary epithelial biology. Partial support comes from the Keep-a-Breast Foundation (J.A.B.).
Poster #: 33
Project Title: Investigating on the binding affinity and the conformational changes of the biologically important RNA-peptide complexes of Brome Mosaic Virus
Author List:
Hui, Kai-Cheung; Graduate, Chemistry & Biochemistry, California State University, East Bay, Presenting Author
Fall, Lalla ; Graduate, Chemistry & Biochemistry, California State University, East Bay, Presenting Author
Xian, Licheng; Undergraduate, Chemistry & Biochemistry, California State University, East Bay
Kim, Chul-Hyun; Faculty, Chemistry & Biochemistry, California State University, East Bay
Abstract: RNA-protein interactions conduct important roles in various bio-organisms. These interactions are important in the life cycles of viruses such as clinically important ones (HIV and Hepatitis Virus) as well as agriculturally significant ones (Brome Mosaic Virus (BMV). BMV infects granary plants and serves as a model system for systemic research on the replication mechanism of these viruses. The coat protein (CP) of BMV coordinates the timely RNA replication through the binding of its N-terminal region to the specific part of BMV RNAs (RNA promoter motifs). It is important to understand how these RNAs bind to the N-terminal region of CP and whether the binding is structure-dependent or sequence-dependent. In order to answer these questions, we prepared a 27 amino acid-long peptide (CPNT), mimicking the N-terminal region of CP, as well as two RNA sequences (SL13 and Bbox), representing the RNA promoter regions of the RNA of BMV. Our data from Nuclear Magnetic Resonance Spectroscopy (NMR) and Circular Dichroism (CD) study suggested that CPNT in its free form assumes a flexible conformation with little alpha-helicity. Fluorescence studies on CPNT-RNA complexes showed that CPNT “weakly” binds to both SL13 and Bbox RNA motifs (dissociation constant (Kd) = 5.8 microM for Bbox and 8.2 microM for SL13), but not to other RNAs with random sequences (poly-A and poly-U RNAs). Given that its binding is much weaker than the ones found in other viruses, we have adopted a new method, the mobility-shift native gel electrophoresis, which we hoped would provide more reliable estimation of the binding affinity. Our results showed that the RNA band with slower mobility were detected in the lanes of CPNT-RNA mixtures, and their band intensity increased as amount of CPNT increased. The mobility shift was not detected in the lanes with mixtures of CPNT and RNAs with random structures (poly-U and poly-A), suggesting that the binding is structure-specific. Fourier Transform InfraRed (FTIR) study is currently being done on free CPNT as well as mixtures of CPNT and RNAs. Initial results showed that there is a shift toward higher wavenumber in the absorption peaks that are in the region of the vibration of the amide bonds of CPNT, which suggests that CPNT increases its alpha helical conformation upon its binding to SL13 and Bbox RNAs. Detailed data regarding both binding characteristics and conformational changes of RNA-CPNT complexes will be presented at the CSUPERB conference.
Poster #: 34
Project Title: A chimeric protease inhibitor secreted by Escherichia coli with potential for use in biofuel fermentations and therapeutic bacteria.
Author List:
Quintero, David ; Graduate, Biology, California State University, Northridge, Presenting Author
Bermudes, David; Faculty, Biology, California State University, Northridge
Abstract: We genetically engineered a fusion of the E. coli secreted protein YebF with the trypsin inhibitor from sunflower to generate a chimeric protease inhibitor secreted by E. coli. The inhibitor was secreted into the medium free from the bacteria and inhibited trypsin in a petri-plate based protease inhibitor assay and protected azocoll in a colorimetric protease assay. Industrial fermentations are sensitive to bacterial contaminations, especially those due to proteolyic strains such as Lactobacillus sp. We are further examining the ability of protease inhibitor-secreting bacteria to protect extracellular fermentations from proteolytic destruction using α-amylase as a model industrial extracellular fermentation enzyme. Bacteria and fungi secreting protease inhibitors offer a potential augmentation to other extracellular fermentations such as cellulosic ones used in the production of biofuels where microbial contaminations reduce production efficiency. Interestingly, sunflower trypsin inhibitor is also capable of inhibiting matriptase, a major tumor-associated protease correlated with metastasis, and may have use in live therapeutic tumor-colonizing bacteria such as Salmonella strain VNP20009.
Poster #: 35
Project Title: Ion Shedding from Prosthetic Metals Induces DNA Damage in Human B cells & T cells
Author List:
Ramirez, Sonia; Graduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Li, Lucy Wei; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona
Ortega, Danielle; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona
Alas, Steve; Faculty, Biological Sciences, California State Polytechnic University, Pomona
Abstract: In recent years there has been an increase in the rate of prosthetic implant revisions due to osteolysis and implant loosening caused by the release of nanoparticles from the titanium metal prosthesis. Other studies have also suggested that the metal debris and ions can cause DNA single and double strand breaks. The mechanisms by which the nanoparticles and ions induce genotoxity have not been fully studied. In this project, CEM cells (human T-cell line) and Daudi cells (human B-cell line), were grown in culture and exposed to ion solutions derived from corrosion experiments performed on novel titanium-boron alloys. The metals have incorporated different percentages of boron into the commonly used titanium alloy (Ti-6Al-4V). The eleven titanium-boron alloy ion solutions used in this research were the following: Ti-6Al-4V, Ti-6Al-4V-1.09B, Ti-6Al-4V-0.4B, Ti-6Al-4V-0.19B, Ti-6Al-4V- 0.02B, Ti-6Al-4V-0.04B, Ti-6Al-4V-0.5B, Ti-6Al-4V-0.10B, Ti-6Al-4V-0.01B, Ti-6Al-4V-0.001B, Ti-6Al-4V-0.04B, and Ti-6Al-4V-0.43B. Saline concentration curves demonstrated that a mixture of 70% saline and 30% growth media was the highest saline concentration the cells could be treated with, without the saline solvent inducing a high level of cell death. Saline was used to set the concentration curve due to the corroded ions dispersed in a 0.9% saline solvent which mimics the percentage of saline in the human body. CEM cells and Daudi cells were incubated for 24 and 48 hours in solutions consisting of a 70% ion solution (in 0.9% saline) and 30% media. A FACSCalibur Flow Cytometer was used to analyze apoptosis of the cells after exposure to the titanium-boron alloy ion solutions and the Comet Assay was used to evaluate DNA damage. We observed that titanium ions shed from the traditional and novel metals did not induce apoptosis of CEM cells or Daudi cells when exposed to the ion solutions for 24 and 48 hours. However, the ions induced CEM and Daudi DNA damage at 6, 12, and 24 hour incubation time points. The populations of cells treated with different ion solutions were compared to determine whether exposure to the shed ions from the titanium-boron alloys produce less DNA damage than traditional titanium alloy (Ti-6Al-4V). Results show that there is equally relevant DNA damage from both the traditional titanium alloy and the novel titanium-boron alloys.
Poster #: 36
Project Title: Staphylococcus epidermidis and Pseudomonas aeruginosa Biofilm Formation on Plasma Treated Prosthetic Alloys
Author List:
Reyes, Selma; Graduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Alvarado, Aaron; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona
Kabot, Lindsay; Undergraduate, Physics and Astronomy, California State Polytechnic University, Pomona
Abramzon, Nina; Faculty, Physics and Astronomy, California State Polytechnic University, Pomona
Alas, Steve; Faculty, Biological Sciences, California State Polytechnic University, Pomona
Abstract: We are currently in an age when the use of prosthetic implants is on the increase. Prosthetics commonly fail due to colonization by bacteria. Once bacteria colonize the prosthetics, the biofilm produced protects them from susceptibility to antibiotics. The most prevalent infections leading to implant colonization are from Staphylococcus epidermidis (gram positive) and Pseudomonas aeruginosa (gram negative). Our long-term goal is to determine whether a new series of titanium-based alloys are less susceptible to bacterial colonization and make for better human prosthetics. Consequently we are testing biofilm production by S.epidermidis and P.aeruginosa on six different biometals. Three of the metals being tested are traditional metals used for prosthetics; commercially pure titanium (CpTi), a titanium-based alloy (Ti-6Al-4V), and stainless steel (SS). The additional three metals we are testing are new Ti-6Al-4V alloys having different percentages of boron; 1.0, 0.4 and 0.05. Our first goal is to study bacterial colonization of these biometals by measuring biofilm formation on the surface of each metal after bacterial exposure for 48 hours. Results showed that the alloys resist P.aeruginosa colonization better than traditional stainless steel, but not as well as the base alloy Ti-6Al-4V with no boron. Similar results were seen using S.epidermidis, which colonized the new alloys and Ti-6Al-4V less than stainless steel. Thereafter, we studied whether pretreatment of the biometals with plasma reduced colonization by bacteria even further. We treated the traditional metals (CpTi, Ti-6Al-4V, SS) as well as new Ti-6Al-4V boron-containing metal alloys (0.01%, 0.04%, 0.43%) with oxygen plasma to alter their surface microstructure and quantified the bacterial biofilm formation. We have found that the plasma treated boron metals alloys do not provide a viable surface for bacteria to colonize and that the plasma treated traditional metals have lower biofilm formation when grown with P.aeruginosa. For the last part of our project we will follow the same parameters to measure the biofilm formation of S.epidermidis on both traditional metals and boron metal alloys. Our goal is to find a metal with low bacterial colonization in order to help increase the success of prosthetic implantation.
Poster #: 37
Project Title: GENOMIC-BASED BIOCOMPATIBILITY ASSESSMENT OF TITANIUM (IV) DIOXIDE (Ti(IV)O2) NANOPARTICLES
Author List:
Chandrasekhar, Shreya ; Graduate, Biomedical, Chemical, and Materials Engineering, San José State University, Presenting Author
Hans, Harjot; Undergraduate, Biomedical, Chemical, and Materials Engineering, San José State University, Presenting Author
Wesley, Leonard; Faculty, General Engineering, San José State University
Summan, Rafia; Undergraduate, Biomedical, Chemical, and Materials Engineering, San José State University
Le, Tami ; Undergraduate, Biomedical, Chemical, and Materials Engineering, San José State University
Sandhu , Ashleen; Undergraduate, Biomedical, Chemical, and Materials Engineering, San José State University
Bhogal,, Guneet; Undergraduate, Biomedical, Chemical, and Materials Engineering, San José State University
Abstract: Titanium, due to its biocompatibility and mechanical properties, is one of the most commonly used biomaterials for the manufacture of dental implants [1]. A growing amount of literature reports that nanosized particles of titanium dioxide (TiO2) can be precursors to cancerous lesions in osteoblast cells [2]. In-vivo studies conducted on mice reveal DNA damage when exposed to titanium dioxide nano-particles. Recently, the International Agency for Research on Cancer (IARC) has reclassified TiO2 as a group 2B carcinogen.
The results of previous work, suggests that a genomic based biocompatibility assessment of TiO2 can help provide some of the data that can be used to characterize the potential impact and risk to humans of developing osteosarcoma lesions from nanosized particles of TiO2 implant material. This work is also aligned with the trend toward personalized medicine which is intended to provide medical care based on an individual’s genetic makeup.
In this study, the genetic effects of exposing the osteoblast cell MAPK4 gene DNA to varying concentration of TiO2 nano-particles for durations of time ranging from one to three days has begun. Preliminary results indicate that a little as 60ng of TiO2 can chemically bind to portions of the MAPK4 DNA. This is confirmed by gel electrophoresis and spectral analysis experiments. While these preliminary results do not confirm osteosarcoma will follow, it suggests there is a chemical interaction that can alter the function of DNA, such as transcription, and subsequent downstream cellular growth activities.
Future work will involve conducting microarray and NGS (Next Generation Sequencing) experiments to help identify nucleotide mutations.
References
[1] A. Arys, C. Philippart, N. Dourov, Y. He, Q. Le and J. Pireaux, “Analysis of titanium dental implants after failure of osseointegration: Combined histological, electron microscopy, and X‐ray photoelectron spectroscopy approach,” Journal of Biomedical Materials Research, 43 (3), pp. 300-312 (1998).
[2] B. Trouiller, R. Reliene, A. Westbrook, P. Solaimani and R.H. Schiestl, “Titanium dioxide nanoparticles induce DNA damage and genetic instability in vivo in mice,” Cancer Research, 69 (22), pp. 8784-8789 (2009).
Poster #: 38
Project Title: Engineering the S-Layer Protein RsaA in Caulobacter vibrioides for Heavy Metal Bioremediation
Author List:
Merrick-Stammers, Skye; Undergraduate, Biology, Humboldt State University, Presenting Author
De Alba, Christopher; Undergraduate, Biology, Humboldt State University, Presenting Author
Olvera, Michael; Undergraduate, Biology, Humboldt State University
Coblentz, Azariah; Undergraduate, Chemistry, Humboldt State University
Jenkins, Wesley; Graduate, Biology, Humboldt State University
Cappuccio, Jenny; Faculty, Chemistry, Humboldt State University
Abstract: One of the greatest contemporary environmental issues is the pollution of heavy metals into waterways. However, removal of heavy metal ions via bioremediation may be a possible solution. C. vibrioides has a biphasic life cycle that includes stalked and motile life forms. Using modified C. vibrioides paracrystalline RsaA surface layer proteins (S-layer proteins), our team hopes to bind lead, and other metal ions for decontamination through use of a cylindrical filtration system. It is known that modified S-layers can be secreted through a Type-1 secretion system displayed on the microbial surface. Our initial target sequence (TNTLSNN) was chosen for its ability to bind Pb, which we have chosen due to its role as a major contaminant. Attachment of serine, glycine, and glutamic acid flanking sequences were used to increase the stability and assist in secretion of the modified RsaA proteins. We have also generated 6x-Histidine sequences for their inherent binding to metals such as Ni, and Co. We confirmed expression of Pb lead binding sequences. The Future goals of our lab include the observations of heavy metal binding efficiencies of each engineered RsaA surface, and the generation of prototype binding cartridges.
Poster #: 39
Project Title: SYNTHESIS OF BIOCONJUGATED LIPID POLYMER HYBRID NANOPARTICLES FOR TARGETED DRUG DELIVERY
Author List:
Le, Lan ; Graduate, Biomedical Engineer, San José State University, Presenting Author
Abstract: In recent years, lipid-polymer hybrid nanoparticles have gain attention as an efficient drug delivery device to treat various diseases, including cancer, cardiovascular disease, diabetes, bacterial infection and so on. Nano precipitation and self-assembly is a common method to synthesize drug encapsulated nanoparticles in a low cost technique. However, the multi-step process of this synthesis method causes difficulty in consistently producing uniformly sized nanoparticles. In this project, the uniform lipid nanoparticles with approximately 100 nm diameters were successfully generated using different concentration of polymers (PLGA), using Multi Inlet Vortex Mixer (MIVM) to improve the synthesis process and were characterized by Fourier Transform infrared spectroscopy (FTIR), dynamic light scattering (DLS), Scanning Electron Microscopy (SEM), and transmission electron microcopy (TEM), and Differential Scanning Calorimetry (DSC). The classification of polymers used were biodegradable polymers poly (D, L-lactic-co-glycolic acid) (PLGA) with varying lactic to glycolic ratios and end groups. The main parameters examined were size of the nanoparticles and the ratio of polymer to lipid used during the development of the nanoparticles.
Poster #: 40
Project Title: Microfluidic device for growth and exposure of bacterial biofilms to varying concentrations of antibiotics
Author List:
Barrera-Barraza, Raul; Graduate, Biomedical, Chemical, and Materials Engineering, San José State University
Hawkins, Benjamin; Faculty, Biomedical, Chemical, and Materials Engineering, San José State University, Presenting Author
Abstract: The majority of nosocomial infections are biofilm-related. These biofilms are more resilient to environmental changes and antibiotic treatment than their planktonic counterparts and, as a result, studies performed on bacteria in their planktonic state do not reflect results obtained in vivo. To address this disparity, biofilm research is receiving increased attention from the scientific community. In particular, microfluidic systems offer an exciting opportunity to address the myriad challenges of biofilm analysis. Depending on the design, microfluidic devices can recapitulate the in vivo physicochemical conditions that drive biofilm formation. Microfluidic devices generally have a small footprint and may perform multiple experimental runs within the same device.
We have developed such a system: using two inlets, a chemical gradient generator was designed to create an exponential concentration profile at its outlet, feeding 16 separate biofilm culture chambers with distinct antibiotic concentrations. The gradient generator takes advantage of parallel flow diffusion by breaking off the incoming streams from the two inlets into several others until the desired concentration gradient is achieved. ELMER multiphysics simulation software was used to simulate the chemical concentration gradient. Experimental verification was achieved using a solution of 50 mM fluorescein in water. The outlet concentration profile varied from 3×10-6 to 44 mM in simulation. Fluorescein concentration was measured by fluorescence microscopy to verify the concentration profile. The concentration at the outlet in both simulation and experiment had an increasing concave down, exponential profile.
Using traditional soft lithography techniques, a poly(dimethylsiloxane) (PDMS) on glass microfluidic device was fabricated. Mycobacterium smegmatis cells were seeded through two channels at the gradient generator’s outlet and forced to flow through the culture chambers. The gradient generator independently fed M. smegmatis biofilms grown in 16 parallel culture chambers within a single device. Once the cells attached to the glass surface and formed biofilms (2 days), they were exposed to ethambutol, a common drug prescribed to treat tuberculosis. To the authors’ knowledge, this is the first microfluidic study of the effect of ethambutol concentration on M. smegmatis biofilm formation. The microfluidic device designed in this study may also be used for other biofilm forming pathogens.
Poster #: 41
Project Title: Novel Methods for 3-Dimensional Spheroid Cultures Using Isogenic Variants of Breast Cancer
Author List:
Whalen, William; Graduate, Biology, California State University, Fresno, Presenting Author
Bush, Jason; Faculty, Biology, California State University, Fresno
Abstract: Traditional cell culture techniques grow cells in a 2-dimensional (2D) format on compatible surfaces, but cells do not grow like this in vivo. A fast emerging alternative is 3-dimensional (3D) cell culture, which encourages cells to work together while suspended in a matrix rather than relying on adhesion to a treated surface. Most studies utilize a commercially available, industry standard recombinant basement membrane substitute—Matrigel®; however, this is proprietary and expensive. For these studies, our goal was to refine an alternative to Matrigel® for use as a suspension media. Our efforts focused on economical Methocel (methylcellulose dissolved into basal growth media) in combination with rat-tail collagen (Type I). Methocel promoted the formation of spheroids among several cell lines including all three isogenic variants of a triple-negative metastatic breast cancer cell line, MDA-MB-231—notoriously difficult to get into spheroid culture. While not required for all cell lines, the addition of collagen (Type I) greatly increased the efficacy of spheroid formation among all cell lines. Once harvested, spheroids were suspended within a Methocel-collagen gel. Cultures were treated with various chemotherapy drugs including bisphosphonates (Ibandronate and Zoledronic acid) and Docetaxol. The effectiveness of these drugs to inhibit metastasis of the MDA breast cancer variants through a surrogate extracellular matrix was determined by the amount of invasion as measured by distance migrated from the spheroid periphery. Side-by-side comparison showed that identical cell-lines are producing different amounts of certain proteins when grown under different conditions, 2D vs. 3D. Furthermore, using RT-PCR to evaluate canonical cell adhesion molecules, we see varying degrees of gene expression in a time-dependent manner between MDA-MB-231 isogenic variants when grown in the presence of chemotherapeutic drugs. Ultimately, this cost effective system allows for an in vivo-like microenvironment to study tumor development and metastasis.
Poster #: 42
Project Title: Implementation of a microfluidic platform for the study of antibiotic treatment efficacy of Microbacterium smegmatis biofilms
Author List:
Khuc, Daniel; Graduate, Biomedical, Chemical, and Materials Engineering, San José State University, Presenting Author
Sugiarto, Sista; Graduate, Biomedical, Chemical, and Materials Engineering, San José State University, Presenting Author
Hawkins, Benjamin; Faculty, Biomedical, Chemical, and Materials Engineering, San José State University
Abstract: Tuberculosis is a widespread disease caused by Mycobacterium tuberculosis, which commonly plagues the respiratory system, leading to pathogenic transmission through the air. It is estimated that 1 million people died from the disease in 2012, with 8.6 million new cases diagnosed worldwide. Tuberculosis can be treated through an extensive regimen of antibiotics and monitoring. Noncompliance problems result in less than ideal drug concentration profiles. Recent studies indicate that biofilm production by M. tuberculosis plays a role in pathogenicity and drug resistance. There is a need for new, high throughput techniques to investigate antibiotic efficacy against biofilm mediated infections. In this work, we develop a microfluidic approach to address this need and report the response of mycobacterial biofilms to varying concentrations of the antimycobacterial ethambutol over time.
Biofilms are excreted extracellular polymeric substance protecting the microorganisms from chemical and physical assault. In this study, M. smegmatis was used as a non-pathogenic, fast-growing alternative to the pathogenic species M. tuberculosis. Previous studies have shown that biofilm formation impacts the efficacy of antibiotic treatment. This project’s focus is the cultivation of M. smegmatis biofilms and study of the effects of antibiotic treatment profiles over time.
A single microfluidic device was used to culture 16 separate biofilms under 8 different antibiotic conditions. Through a diffusive gradient generator, bacterial chambers are exposed to the antibiotic ethambutol after an initial growth phase under minimal media. Surface shear stress is tuned to confine biofilms to the culture chambers by modulating microfluidic channel depth. To check for biofilm health against bacterial survivability, two fluorescent dyes, which stain for cellular components and matrix proteins, are used to distinguish between the components. For comparison, petri-plated cultures undergoing similar antibiotic treatment are referenced.
Image analysis is used to study shifts in cellular density and biofilm morphology in response to antibiotic treatment. By examining these quantitative measures of biofilm colony morphology with sophisticated statistical models, antibiotic regimens can be tuned for maximal efficacy across dosage, frequency, and compound. The results of this work can be used as a model for continued studies of other biofilm-mediated nosocomial infections.
Poster #: 43
Project Title: Sensitive Detection of Colorectal Cancer Biomarker Carcinoembryonic Antigen by Laser Wave-Mixing Detection and Microchip Electrophoresis
Author List:
Pradel, Sebastien; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Tong, William; Faculty, Chemistry and Biochemistry, San Diego State University, Presenting Author
Abstract: Nonlinear multi-photon laser wave mixing is presented as a sensitive absorption-based method for early detection and diagnosis of colorectal cancer biomarker carcinoembryonic antigen (CEA) and bacterial meningitis proteins. Wave mixing offers inherent advantages over conventional methods including zeptomole-level detection and high spatial resolution suitable for single-cell analysis. The wave-mixing signal is a coherent laser-like beam, and hence, it can be collected with excellent S/N. CEA absorbs in the UV wavelength range and it can also absorbs in the visible range when labeled with a chromophore. We use a 532 nm visible laser when labeled with a chromophore and a 266 nm UV laser to probe label-free analytes. Our wave-mixing signal has a quadratic dependence on analyte concentration, and hence, wave mixing is especially effective for monitoring small changes in analyte properties. In order to enhance chemical selectivity, a capillary (75 µm i.d.) or a microchip (25 µm channel) is used to separate analytes in our custom-built CE or microchip CE system. The wave-mixing probe volume is small (nano liter), and hence, it is inherently suitable for interfacing to microfluidics and lab-on-a-chip systems. Our wave-mixing detection sensitivity levels are comparable or better than those of fluorescence detection methods and wave-mixing detection is applicable to both fluorescing (labeled) and non-fluorescing (label-free) samples. Potential applications include detection of biomarkers, single-cell analyses and early detection of diseases. Our nonlinear multi-photon detectors can be easily configured as battery-powered portable devices that are suitable for use in the field where resources are limited.
Acknowledgments: NIH R01, NSF, U.S. Army, U.S. DHS
Poster #: 44
Project Title: Tissue Engineering the Geometry of 3D Cardiac Structures That Beat on Shaped Biocompatible Matrices
Author List:
Ma, Tawei; Undergraduate, Arts and Sciences, Oxnard College, Presenting Author
Ma, Rocio; Undergraduate, Arts and Sciences, Oxnard College
Su, Ellisa; Arts and Sciences, Oxnard College
Zuniga, Emilio; Graduate, Arts and Sciences, Oxnard College
Browne, Greg; Undergraduate, Arts and Sciences, Oxnard College
Harber, James; Faculty, Arts and Sciences, Oxnard College
Abstract: Regenerative cardiac repair in human clinical trials has demonstrated that a patient’s own cardiac cells differentiated in vitro and transplanted autologously can dramatically improve cardiac function. In model systems, in vitro differentiation of cells with stem like properties for the mesoderm cardiac lineage is currently limited to microscopic beating clusters. Potentially, larger beating structures could be shaped as vessels and used as supplemental cardiac organs, thus augmenting heart function distally to support blood pressure and move blood. The hypothesis of this project is that specifically shaped three-dimensional beating cardiac structures derived from mouse stem cells growing on a synthetic matrix can be differentiated via the wnt signal transduction pathway. The results were that the P19.CL6 cells in tissue culture (using α-MEM +10% FBS media) were differentiated to beating cardiac tissue using 1% DMSO on a variety of matrix materials including fibrin (polymerized from fibrinogen and thrombin), gelatin and molded plastic. Several tissue culture surfaces (coated, uncoated and ultralow binding) were used as substrates for matrix construction. Springy polymerized fibrin matrix was superior to other materials for directing controlled strand like growth of beating cardiomyocytes. The characteristically rectangular cardiac cells grew slowly on fibrin over the course of three months into ropes of parallel brick like striated tissue superstructures. The localization of coordinate beating structures on fibrin was facilitated by observing contractions that pulsed across the suspended strands of the three-dimensional structure. Longevity of cardiomyocytes differentiated on fibrin from stem cells relative to those on plastic, gelatin and tissue culture coated surfaces was observed. Cardiomyocyte matrix structures initiated on fibrin are biocompatible and potentially implantable. These studies of cardiogenesis also address a well known barrier: the human heart’s inability to replace scar tissue matrix consisting of fibrin generated in a heart attack with functional beating tissue.
Poster #: 45
Project Title: Ketamine exposure during adolescence alters responses to mood-related stimuli in adulthood
Author List:
Hernandez, Mirella; Undergraduate, Psychology, California State University, San Bernardino, Presenting Author
Alipio, Jason; Undergraduate, Psychology, California State University, San Bernardino, Presenting Author
Cruz, Bryan; Undergraduate, Psychology, California State University, San Bernardino
Iñiguez, Sergio; Faculty, Psychology, California State University, San Bernardino
Abstract: Mood-related illnesses, such as major depression and general anxiety disorder affect up to 10% of the pediatric population. The available pharmacological treatments are less than ideal since close to 40% of clinically depressed youth do not respond to traditional antidepressants – thus, highlighting the need for better and more effective pharmacological agents. Recently, ketamine, a non-competitive N-methyl-D-aspartate receptor antagonist, has shown great promise as a potential rapid acting treatment for clinical depression at the clinic. Exposure to ketamine during early stages of development is surprising given ketamine’s potential for abuse, as well as the lack of preclinical data assessing its safety and efficacy in the juvenile population. Thus, this study was designed to examine whether exposure to ketamine during adolescence results in altered responses to mood-related stimuli in adulthood. To do this, we exposed postnatal day (PD)-35 male c57bl/6 mice to ketamine (0 or 20 mg/kg) for 15 consecutive days (PD35-49). Their behavioral reactivity to anxiety- and stress-eliciting situations (i.e., open field test, forced swim test), including rewarding stimuli (i.e., sucrose preference) was assessed three-weeks after ketamine exposure (i.e., PD70+). Adult mice receiving ketamine during adolescence exhibited a decrease in sensitivity to aversive situations, as inferred from the forced swim test. Furthermore, ketamine-pretreated animals also displayed an enduring preference for a sucrose solution, when compared to saline-pretreated controls. Together, these data suggest that adolescent exposure to ketamine results in altered behavioral responses to stress- and reward-related stimuli in adulthood. Our findings further highlight the need for future research to improve our understanding of the neurobiological alterations that psychotropic drug exposure may induce on the developing nervous system.
Poster #: 46
Project Title: Ketamine reverses depressive-like behavior after adolescent social defeat stress
Author List:
Riggs, Lace; Graduate, Psychology, California State University, San Bernardino, Presenting Author
Flores, Francisco; Graduate, Psychology, California State University, San Bernardino, Presenting Author
Shawhan, Kristi; Undergraduate, Psychology, California State University, San Bernardino
Zamora, Norma; Undergraduate, Psychology, California State University, San Bernardino
Iñiguez, Sergio; Faculty, Psychology, California State University, San Bernardino
Abstract: Approximately 10% of children and adolescents are diagnosed with major depressive disorder (MDD). Unfortunately, close to 40% of depressed youth are unresponsive to traditional pharmaceutical treatments, such as fluoxetine (Prozac), which reflects the need to identify alternative compounds for the management of juvenile MDD. In adult populations, ketamine, an N-methyl-D-aspartate receptor antagonist, has recently shown the capacity for rapid-acting antidepressant efficacy in both preclinical and clinical studies. Thus, to examine ketamine’s potential as a rapid and effective antidepressant therapeutic agent for juvenile MDD, ketamine was administered to adolescent male c57BL/6 mice while undergoing social defeat stress for 10 consecutive days (postnatal days 35-44) – a stress regimen that results in depression-like behaviors in mice (Iñiguez et al., Stress, 2014). Specifically, separate groups of stressed (defeated) and non-stressed (control) mice were administered with ketamine (20 mg/kg) either immediately after each daily episode of defeat (chronic; 10 exposures), or following the last day of stress (acute; single exposure). Twenty-four h later (postnatal day 45), all mice were tested for depression-like behavior, as inferred from the social interaction/avoidance test. As expected, defeated adolescent mice administered with saline (chronic or acute) exhibited a depressive-like response (i.e., increased social avoidance). Conversely, exposure to ketamine (chronic or acute) prevented the development of the stress-induced avoidance phenotype. Together, these findings indicate that ketamine may be a potential novel agent for the treatment of juvenile MDD.
Poster #: 47
Project Title: The use of pregnancy-specific direct anthropometric equations in an overweight or obese Hispanic pregnant population
Author List:
Reisenberg, Amy; Graduate, Nutrition, Food Science & Packaging, San José State University
Sawrey-Kubicek, Lisa; Children’s Hospital Oakland Research Institute
Henderson, Mary ; Children’s Hospital Oakland Research Institute
King, Janet; Children’s Hospital Oakland Research Institute
Mauldin, Kasuen; Faculty, Nutrition, Food Science & Packaging, San José State University, Presenting Author
Abstract: In health care settings, overweight and obesity are defined using body mass index (BMI = kg/m2). There are disadvantages to using BMI to diagnose obesity as the amount of body fat can vary widely among individuals with the same BMI. Studies show that body fat percentage (%BF), more than BMI, is a better predictor of health risk. The measurement of body fat is not routine nor necessary in all clinical settings, but during pregnancy – a time when weight gain is socially acceptable, expected, and often in excess – the use of body fat rather than BMI to plan perinatal care would be more useful and precise. In fact, maternal %BF during pregnancy has been shown to more accurately predict perinatal outcomes than traditional assessment of maternal weight gain during pregnancy. Of the various methods to determine %BF, anthropometry (measurement of weight, height, circumferences, skinfold thicknesses) is the most cost-efficient and practical method for the typical clinical setting. While two predictive %BF equations (Presley and Paxton) have been established based on anthropometry for pregnancy in general, these equations have not been specifically tested in a metabolically at-risk pregnant population, such as overweight/obese pregnant Hispanic women. Our specific aim is to investigate whether the current established equations for estimating maternal %BF using anthropometry are accurate for this higher-risk population as compared to the gold-standard technique of calculating %BF from direct measurements of body density and total body water. Our study population included 15 pregnant Hispanic women (average age 27 years old) in their third trimester with pre-pregnancy BMI between 25 – 40 kg/m2. Eight body measurements were used in the two pregnancy-specific direct anthropometric equations. Body density was measured using air displacement plethysmography and total body water was measured using deuterated water. To our knowledge, this is the first study in pregnancy to use air displacement plethysmography to measure body density. Data suggests that the Presley equation for estimating %BF (average 40.1% +/- 5.6%) from anthropometric measures is more accurate then the Paxton equation (average 50.4 % +/- 2.6%) as compared to the gold-standard technique (average 40.7% +/- 4.4%). Our findings give clinicians a reliable and accessible method for tracking body fat gain in their metabolically at-risk pregnant population.
Poster #: 48
Project Title: Ontogeny of one-trial nicotine-induced behavioral sensitization in male and female rats.
Author List:
Su, Alan; Undergraduate, Psycholgoy, California State University, Long Beach, Presenting Author
Bin, Timothy; Undergraduate, Psychology, California State University, Long Beach
Seng, Sarret; Undergraduate, Psychology, California State University, Long Beach, Presenting Author
Zavala, Arturo; Faculty, Psychology, California State University, Long Beach
Abstract: One-trial locomotor sensitization is the process by which a single exposure to a drug results in a progressively higher locomotor behavioral response during a subsequent drug exposure. Adult rats (postnatal day (PD) 90 or above) readily exhibit one-trial locomotor sensitization to cocaine, but only within the context (i.e., the environment) where the initial drug administration took place. In contrast, juvenile rats exhibit one-trial locomotor sensitization regardless of the context where the drug was administered. The ontogeny of one-trial locomotor sensitization to nicotine remains unknown. However, nicotine, like cocaine, is a psychomotor stimulant that enhances the locomotor activity of rats when administered acutely. Thus, the present study examined the ontogeny of one-trial nicotine context-dependent locomotor sensitization. PD 35 male (n=83) and female rats (n=87) were treated subcutaneously (SC) with either saline or nicotine (0.3, 0.6, 0.9, or 1.2 mg/kg) and immediately placed in a novel test chamber where their horizontal locomotor activity was measured for 45 minutes. Following pretreatment, all rats were returned to the home cage and left to recover for an additional 45 minutes. Following recovery, rats initially pretreated with saline were then injected with nicotine (0.3, 0.6, 0.9, or 1.2 mg/kg, SC) and returned to their home cage, whereas rats initially pretreated with nicotine received a saline injection. The following day, all rats received an injection of nicotine (0.3 mg/kg, SC) prior to being placed in the test chamber. Horizontal locomotor activity was then measured for 45 minutes. Results indicate that rats do not exhibit locomotor sensitization after a single exposure to nicotine on PD 35 regardless of sex, pretreatment dose, and context of drug administration,. These findings suggest that the ontogenetic profile of nicotine one-trial locomotor sensitization does not occur during the adolescent period of development. These findings warrant further research into the age at which one-trial sensitization to nicotine develops, as well as whether the sensitization response will be context-dependent.
Poster #: 49
Project Title: The Rewarding Effects of Nicotine are Modulated by Juvenile Exposure to Ketamine in a Sex Dependent Manner in Rats
Author List:
Bowman, Melodi ; Graduate, Psychology, California State University, Long Beach, Presenting Author, Eden Award Finalist
Hernandez, Kimberly; Undergraduate, Psychology, California State University, Long Beach, Presenting Author
Schuessler, Bryan; Undergraduate, Psychology, California State University, Long Beach
Vincent, Matthew; Graduate, Psychology, California State University, Long Beach
Iniguez, Sergio; Faculty, Psychology, California State University, San Bernardino
Zavala, Arturo; Faculty, Psychology, California State University, Long Beach
Abstract: Nearly 10% of the pediatric population is diagnosed with major depressive disorder (MDD) and the use of selective serotonin reuptake inhibitors to manage their symptoms is often not effective. This has resulted in a need for novel alternative compounds for the treatment of MDD in pediatric populations. Recently, low doses of ketamine, a glutamate NMDA receptor antagonist, has been shown to produce fast-acting and long-lasting antidepressant effects. However, because ketamine is also an abused drug, it is unclear what the long-term effects of early and extended use of ketamine may be. Of particular concern is that early exposure to ketamine might increase the abuse potential of other drugs of abuse that are prevalent in adolescents, such as nicotine. Thus, we examined whether early exposure to ketamine increases the rewarding effect of nicotine in adolescent rats using the conditioned place preference (CPP) paradigm. Male and female Sprague-Dawley rats were treated daily with ketamine (0 or 20 mg/kg, IP) from postnatal day (PD) 21-30. Rats were then assessed for nicotine-induced CPP beginning on PD 33 using a 10-day CPP procedure. During days 1 and 10 of the CPP procedure, rats were tested for their preconditioning and postconditioning place preference, respectively, in 15-minute sessions. During days 3-8, rats were conditioned 30-minutes a day with either nicotine (0.0, 0.1, 0.3, or 0.6 mg/kg, SC) or saline on alternating days. Days 2 and 9 were rest days. Results demonstrate that early exposure to ketamine modulates the rewarding effects of nicotine in female, but not male rats. Specifically, female adolescent rats pretreated with ketamine showed a shift toward the nicotine-paired side when injected with the 0.3 mg/kg dose, whereas female adolescent controls failed to exhibit any changes in preference with this dose. Interestingly, at the 0.6 mg/kg dose of nicotine, female adolescent rats pretreated with ketamine exhibited a shift towards the aversive effects of nicotine, whereas controls demonstrated preference for this dose. These findings suggest a possible left-ward shift in the dose response to nicotine with prior ketamine exposure. In contrast, male adolescent rats pretreated with ketamine exhibited a similar pattern of nicotine-induced CPP to controls. Results show that the use of ketamine early in development may lead to long-term functional changes that may predispose females to nicotine addiction.
Poster #: 50
Project Title: Integration of Disordered Residue Propensity as a Predictor in Logistic Regression for Determining Solvent Accessible Protein Elements
Author List:
Kamath, Thejas; Undergraduate, Chemistry, San José State University
Bhogal, Guneet; Undergraduate, Biomedical, Chemical and Materials Engr., San José State University
Poelman, Thomas; Undergraduate, Chemistry, San José State University
Bros-Seemann, Shannon; Faculty, Biology, San José State University
Kantardjieff, Katherine; Faculty, College of Science and Mathematics, California State University San Marcos
Gottlieb, Andrea; Faculty, Mathematics and Statistics, San José State University
Lustig, Brooke; Faculty, Chemistry, San José State University
Abstract: Prediction of relative solvent accessibility (RSA) from protein sequence is often seen as an interesting computational problem, allowing for the development and/or application of novel computational methods. Logistic regression is proving to be such a useful approach, integrating sequence-based qualitative predictors such as amino acid type, with quantitative ones. One potential predictor of interest involves the propensity of a residue, given a particular set of sequence neighbors, to be disordered.
We introduce as a predictor the Lobanov-Galzitskaya disorder propensity, which among a number of uses has shown utility in describing protein-protein interfaces. The propensities are determined using an Ising model that encompasses non-adjacent and adjacent neighbors. We included it into our logistic models for predicting protein residues as buried or accessible to solvent. Earlier regression models utilized a small set of homology-based quantitative predictors, including 20-term (E20) and 6-term (E6) sequence entropy, and qualitative descriptors of the query residue type. From X-ray crystal structure the program NACCESS calculates RSA values, which are then converted into binary classifications of either accessible or buried to be used as responses in logistic models. This binary classification of the percent RSA values first applies a conventional 20% (and later 25%) threshold to assign the residue as being buried or accessible. These models are first fitted using a domain-complete 1363-protein training set and then applied to a test set generating predicted classifications. It was also determined by SPSS that alone among the quantitative predictors, E6 and E20 are highly correlated logistic descriptors, where E6 remains the more reliable as far as prediction accuracy.
Incremental increases in accuracies for the Manesh-215 and CASP8+9 test sets were noted with addition of non-homology predictors, notably the Lobanov-Galzitskaya residue disorder propensity. Overall accuracy exceeding 75% was noted, though slightly better accuracies are indicated for non-oligomers. Interestingly, this difference associated with oligomerization is most pronounced for homology-based predictors, suggesting an oligomer-related conservation signal that is consistent with other observations. Moreover, our models are very simple and include novel physically-based descriptors, better allowing for large-scale searches of potential protein-protein interfaces.
Poster #: 51
Project Title: Development of Second Generation RNA-Protein Statistical Potentials
Author List:
Nguyen, Thu; Undergraduate, Chemistry, San José State University
Tran, Phuc; Undergraduate, Chemistry, San José State University, Presenting Author
Kimura, Takayuki; Graduate, Chemistry, San José State University, Presenting Author
Park, Amos; Undergraduate, Chemistry, San José State University
Cesare, Ariana; Undergraduate, Chemistry, San José State University
Nguyen, Loc; Graduate, Chemistry
Shalan, Reema; Undergraduate, Biomedical, Chemical and Materials Engr., San José State University
Lustig, Brooke; Faculty, Chemistry, San José State University
Abstract: Computational modeling of RNA-protein interactions remains an important endeavor. This is in part the result of the accelerated identification of novel non-coding RNAs that exhibit a wide variety of function and interaction. However, exclusively all-atom approaches that model RNA-protein interactions via molecular dynamics and related methods are often problematic in their application. This is very likely a result of limitations involving RNA flexibility and certain force field potentials that prove problematic in such complexes. One possible alternative is the implementation of hierarchical approaches, first efficiently exploring configurational space with a coarse-grained representation of backbone placements, such as described in ROSETTA and in various lattice model approaches. Subsequently, the lowest energy set of such coarse-grained models can be used as scaffolds for all-atom placements, a standard method in modeling protein 3D-structure. However, this likely will require improved ribonucleotide-amino acid potentials as applied to coarse-grained structures.
As a first test, we applied our established Lustig-Jernigan (1997) ribonucleotide-amino acid potentials on an updated coarse-grained model calculation involving some 100-million lattice structures for BIV TAR-Tat. The native target Tat peptide was identified within the lowest 0.28% of lattice structures as evaluated by these ribonucleotide-amino acid potentials. However it appears there remains an opportunity for even better native-target identification in the TAR-Tat model and other coarse-grained examples by further refining the potentials. As a first step we applied to the original 1997 RNA-protein contacts, BLASTN-defined RNA variants replacing those determined from the original small-RNA databases. The ordering of the quartet of potentials for each of 5 key amino acids (A, R, N, Q, E) remains largely consistent. Moreover, the correlation plot of BLASTN-derived potentials versus the older corresponding potentials show a straight-line fit with slope 1.15; y-intercept of 0; corr. coeff. 0.529 and P<0.02. This suggests that it is worthwhile to explore a much larger ensemble (over 600) of post-1997 RNA-protein complexes, using ribonucleotide-amino acid contact information from X-ray and sufficient complementary RNA variant data. An updated expression for normalizing the potentials that includes accounting for random substitutions shows promise in further refining these potentials.
Poster #: 52
Project Title: Predicting the Binding Modes of Antifreeze Proteins to Methyl α–D-Mannopyranoside Crystal
Author List:
Diaz, Arnold; Undergraduate, Chemistry and Biochemistry, California State University, Los Angeles, Presenting Author
Liu, Fan; Materials and Process Simulation Center, California Institute of Technology
Kim, Sook-Yung; Materials and Process Simulation Center, California Institute of Technology
Goddard III, William A.; Materials and Process Simulation Center, California Institute of Technology
Wen, Xin; Faculty, Chemistry and Biochemistry, California State University, Los Angeles
Abstract: Antifreeze proteins (AFPs) are a class of polypeptides that can be found in organisms that live in sub-zero temperatures. These proteins lower the freezing point of water by a few degrees without affecting the melting point; termed thermal hysteresis (TH). The objective of this project is to predict the binding modes of an antifreeze protein from the beetle Dendroides canadensis (DAFP1) with the sugar crystal methyl α-D mannopyranoside (MADM). DAFP-1 can inhibit the crystal growth and recrystallization of MADM and the binding of DAFP1 to MADM crystals has been demonstrated in our recent publication. Bio-software and molecular dynamics (MD) simulations were used to model both structures and calculate the free energies of the binding planes. The binding-site motif of DAFP1 was compared to three different planes on a supercell of the MADM crystal. The planes correspond to an X, Y, or Z plane of the supercell MADM crystal. The planes of the supercell MADM crystal, matched the crystal lattice found on the DAFP1 binding site. MD was conducted on the planes with DAFP-1, to determine the free energies of the complex. The simulation and MD results provided not only further evidence for the interactions between DAFP-1 and MADM, but also atomic-level insights into the crystallization control of non-ice like crystals by AFPs.
Acknowledgements
A.D. thanks Howard Hughes Medical Institute MURF Fellowship and Student-Faculty Programs (SFP) and Alejandra Rios for helps. X.W. thanks the support by NIH (GM086249).
Poster #: 53
Project Title: Analysis of Differential Gene Expressions in Three Sister Species of Coccolithophores for an Understanding of Biomineralization
Author List:
Arango, Aurelio; Undergraduate, Computer Science and Information Systems, California State University San Marcos, Presenting Author
Zhang, Xiaoyu; Faculty, Computer Science and Information Systems, California State University San Marcos
Read, Betsy; Faculty, Biology, California State University San Marcos
Abstract: Coccolithophores play an important role in the marine world because of their abundances and abilities to fix atmospheric CO2 though photosynthesis. They are often characterized by forming an outer sphere of calcite plate known as coccoliths. Understanding the genes responsible for coccolithophorid biomineralization, i.e. the formation of coccoliths, is of particular importance to those in the biomedical and material science field. In this study, we compared the profiles of differentially expressed genes in the transcriptomes of three sister species of coccolithophores, Emiliania huxleyi, Gephyrocapsa oceanica and Isochrysis galbana. The three species were selected because they are closely related but have different phenotypes. For the analysis, about 50 million pair-end illumine reads were sequenced for the three species under four different growth conditions: 0mM calcium, 9mM calcium, 0mM calcium with sodium carbonate spike and 9mM calcium with sodium spike. We used the Trinity de-novo assembler to create transcriptomes for each of the species, and estimate the expression level of each gene and isoform using the alignments of short reads and the RSEM algorithm. The genes with different expression profiles in each species were extracted using statistical tools like edge-R. Then the differentially expressed genes were compared across species. 151 genes found to be differentially expressed between the 0mM versus 9mM growth conditions in E. huxleyi and G. oceanica, but not in the non-calcifying specie of I. galbana. These candidate genes were clustered into groups for further analysis and experimental validation.
Poster #: 54
Project Title: Analysis of perceptual mechanisms related to control of travel direction in navigation of ants
Author List:
Lent, David; Faculty, Biology, California State University, Fresno, Presenting Author
Abstract: How do animals successfully navigate and interact with their environment? An insect foraging for food may travel tens of meters. It will encounter local and global visual cues (e.g. trees, horizon) as well as other sensory cues. Yet, as the insect sets out, it cannot know which information is relevant to its return home or return to an as-yet-unfound site. The insect needs neural mechanisms to identify and store relevant information. These mechanisms must be robust against environmental instability or noise (e.g. obscured visual landmarks or changes in lighting). The goal in real world navigation is to maximize stability by combining information about multiple sensory stimuli, contextual cues, motor actions and past experiences. An understanding of dynamic control systems will reveal how the nervous system has evolved to handle unpredictability and drive the development of novel navigational algorithms and biological sensors. The behavioral output of ants foraging in laboratory settings has revealed a number of visual features used to guide familiar routes. These behaviors have been used to develop image analysis algorithms to extract known visual features that wood ants use for guidance in naturalistic panoramic scenes. Analyzing a series of panoramic images from a wooded area that is similar to the foraging terrain of wood ants and carpenter ants used in the lab, revealed a number of potential guiding features. There were local features such as edges, peaks, and troughs available to guide routes, as well as global features such as scene center of mass and segmented centroids. Analysis of a ‘manmade’ complex scene revealed a vertical-edge dominated environment. Progressing through a series of these images representing a distance of 0.5m revealed how visual features change as a function of an insect’s movement through the environment. Progressing over even a short distance produced considerable instability in nearby local features. However, there were several stable features that could be used to provide reliable landmarks to facilitate route learning. These image analysis algorithms can rapidly extract visual information from any scene and provide testable predictions about the reliability and stability of specific visual features within complex, and cluttered panoramic scenes.
Poster #: 55
Project Title: SUPPORT VECTOR MACHINE (SVM) PREDICTION OF BRAF V600E MUTATION INHIBITORS
Author List:
Rao, Sheela; Graduate, Biomedical, Chemical, and Materials Engineering, San José State University, Presenting Author
Wesley, Leonard; Faculty, General Engineering, San José State University
Abstract: The B-Raf kinase is part of the mitogen activated protein kinase (MAPK) pathway used to signal
and regulate cell mitosis. Of the 30 known types of B-Raf mutations, mutation of B-Raf at the
position V600E has been linked to increased risk of melanoma and colorectal cancer [1]. The B-RafV600E
mutation has been found in 66% of melanomas and 15% of cancers overall [2]. Developing
technologies to rapidly and reliably identify potential inhibitors of the B-RafV600E mutation
has the significant benefit of helping a large segment of the population cope with melanomas
as well as several other types of cancerous lesions.
3D-QSAR is a regression-based modeling technique that has received great attention and success
with predicting affinity of chemical compounds to B-RafV600E targets[3]. Typical prediction accuracies
range between mid to high 60% to high 70%. We have used a supervised learning and classification
algorithm called support vector machines (SVM) to carry out predictions of 213 test compounds that
were not used to train the SVM. Approximately 50% of the test compounds are active as determined
from bioassay results, and the remaining were known not to be active from bioassay test results. The
trained SVM achieved an accuracy of 82% which is significantly higher than traditional 3D-QSAR methods.
Our results to date, suggest that a SVM to prediction of small molecule inhibitors of BRAF V600E mutations
can achieve greater accuracy than quantitative structural activity relationship (QSAR) modeling by at least
ten percent. Continued work will focus on characterizing the features and related aspects of the SVM that
are the primary factors in achieving a significant increase in performance over 3D-QSAR methods to date.
References
[1] Namba H, et al., “Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid
cancers”. J. Clin. Endocrinol. Metab. 88 (9): 4393–7 (2003).
[2] H. Davies, et al., “Mutations of the BRAF gene in human cancer,” Nature, 417(6892), 949-954 (2002).
[3] Kuei-Chung Shih, et al., “Development of Novel 3D-QSAR Combination Approach for
Screening and Optimizing B-Raf Inhibitors in silico”, J. Chem Inf and Modeling, American Chemical Society.
Poster #: 56
Project Title: Determining Efficacy of a Bacterial DNA Fingerprint Library for Microbial Source Tracking using a k-Nearest Neighbors Classification Algorithm
Author List:
McGovern, Jeffrey; Graduate, Computer Science, California Polytechnic State University, San Luis Obispo, Presenting Author
Dekhtyar, Alexander; Faculty, Computer Science, California Polytechnic State University, San Luis Obispo, Presenting Author
Kitts, Christopher; Faculty, Biological Sciences, California Polytechnic State University, San Luis Obispo
Black, Michael; Faculty, Biological Sciences, California Polytechnic State University, San Luis Obispo
Vanderkelen, Jennifer; Faculty, Biological Sciences, California Polytechnic State University, San Luis Obispo
Abstract: Microbial Source Tracking (MST) aims to determine the host source of strains of microbiological lifeforms, in order to properly address issues like fecal contamination in water sources. Fecal provenance is one use for MST that aims to delineate the strains of bacteria that reside within each species of animal. These bacteria are carried into their fecal matter and tend to stay unique to that species.
Sending samples to laboratories for classification is costly and inaccurate, most of the time with only 30% accuracy. Cal Poly students and faculty built the Cal Poly Library of Pyroprints (CPLOP), as an alternative, to facilitate MST. Students collect fecal samples from known species, culture the bacteria, and run a pyrosequencing of the resulting culture in order to create a fingerprint for that bacteria, called a pyroprint. The goal of this library is to provide a database to compare the pyroprints of unknown fecal samples against in order to determine the animal species that sourced the fecal matter.
How useful is this library at supporting MST? Using a straightforward machine learning technique, K-Nearest Neighbors (kNN), as a classification method, we considered each pyroprint in the library to be unknown and classified according to the known pyroprints in the database. We inspect various k and threshold values to gauge which parameters promote accuracy.
K-Nearest Neighbors uses a concept of similarity between pyroprints to classify a pyroprint of unknown origin based on known pyroprints near it. Pyroprints are represented as vectors of real values and the Pearson Correlation Coefficient computes the similarity. K-Nearest Neighbors considers the k most similar known pyroprints and predicts the source species using the most plural species. In our experiments, we chose not to consider k-nearest neighbors that were below a threshold value.
The kNN method has over 85% accuracy for all pyroprints in the database. For bats, kNN achieved over 97% accuracy, while for humans it has over 96% accuracy. Identification of cows and seagulls is over 88% accurate, while detecting dogs, pigeons, and sheep is between 63% and 75% accurate. Species with fewer samples in CPLOP tend to have a lower classification accuracy.
Overall, the kNN method of classification provides an accurate and simple method of classifying fecal matter using CPLOP. Future work will include incorporating the kNN classification method into CPLOP directly for use by researchers.
Poster #: 57
Project Title: Immune Mechanisms Underlying the Racial Disparities in Prostate Cancer
Author List:
Luu, Tracy; Graduate, Biology, San Diego State University, Presenting Author, Eden Award Finalist
Zaeri, Pardis; Graduate, Biology, San Diego State University
Chen, Xin; Department of Pathology, University of CA, Irvine
Saunders, Harmony; Graduate, Biology, San Diego State University
Takahashi, Sam; Undergraduate, Biology, San Diego State University
Mercola, Dan; Department of Pathology, University of CA, Irvine
McGuire, Kathleen L; Faculty, Biology, San Diego State University
Abstract: A racial disparity exists in prostate cancer (PCa), with African Americans (AA) having more aggressive disease and poorer clinical outcomes compared to Caucasians (CA). The immune response in PCa, as well as other cancer types, is critical for inhibiting the growth and progression of tumors. The prevalence of cytotoxic T lymphocytes (CTLs), the major effectors of anti-tumor immunity, within tumor tissues is associated with improved disease-free survival. Strong adaptive anti-tumor responses involve effective antigen presentation for the efficient activation and priming of immune cells that contribute to high CTL activity. We hypothesize that deficiencies in anti-tumor immunity contribute to the racial disparities in PCa.
We have reanalyzed previously published microarray data on PCa for gene expression differences by race. HLA-DMB and HLA-DPA1, two genes important in antigen presentation, are higher expressed in the tumor tissues of CA compared to that of AA. We also found this differential expression of HLA-DMB and -DPA1 to be true at the protein level using tumor microarrays from 105 AA and 443 CA patients. Expression of HLA-DMB increases active CTL responses and improves prognosis in ovarian and breast cancer, suggesting high expression of HLA-DMB may also be linked to effective adaptive immunity in PCa. Our studies also revealed greater infiltration of CD8+ T cells into CA compared to AA tumors, which may be explained by higher gene expression of vascular adhesion protein-1 (VAP1) and a chemokine, CX3CL1, in CA tumors. Differential expression of VAP1 and CX3CL1, lymphocyte recruitment molecules, is currently being validated along with additional immune markers revealed by the microarray analyses using immunohistochemistry (IHC) on the archived PCa samples. Expression of all of these immune markers will be compared with follow-up data to determine if they correlate with better disease-free survival.
A significantly higher degree of CD8+ T cell infiltration into CA tumor tissues, along with stronger antigen presentation compared to AA tumors, suggests crucial differences in the magnitude of anti-tumor immunity between these two patient groups. These findings support our hypothesis that immune processes contribute to the racial disparities in PCa.
Acknowledgements: The authors acknowledge the contributions of J Adams, A Jia, and M Kinseth to these studies. This study was funded by NCI grant 1U01CA162147 and a CSUPERB Joint-Venture grant to KLM.
Poster #: 58
Project Title: Analysis of αvβ8 integrin on Lung Dendritic Cells during Bordetella pertussis: Bordetella pertussis, a Vaccine-Preventable Disease
Author List:
Tylor, Marlene; Graduate, Biology, San José State University, Presenting Author
Llontop, Peter; Undergraduate, Biology, San José State University
Wu, Victoria; Graduate, biology, San José State University
You, Hana; Staff, biology, San José State University
Grover, Amber; Undergraduate, Biology, San José State University
Abstract: Bordetella pertussis(B. pertussis), a gram negative bacteria causes an acute bronchitis infection of the respiratory tract. It infects humans by colonizing the lung epithelial cells. Babies & adults with compromised immune systems are most vulnerable to infection. B. pertussis produces pertussis toxin that disrupts cellular signaling mechanisms, interferes with the chemokine production & inhibits recruitment of immune cells. Lung resident dendritic cells(DCs) capture & process B. pertussis antigens. They up-regulate their co-stimulatory molecules & migrate to the lymph nodes where they interact & activate antigen-specific T cells, inducing an adaptive immune response. CD11b+ & CD103+ are 2 cell surface markers found on conventional dendritic cells(cDCs) that help distinguish cDCs into distinct subsets. αvβ8 is an integrin receptor involved in cell regulation, development & inflammation. αvβ8 expression on DCs is documented to activate TGF-β. TGF-β controls proliferation, cellular differentiation & the conversion of naïve T cells to Th17 & Treg cells. Th17 are a subset of T helper cells that produce interleukin 17 which recruits macrophages & neutrophils to help clear the site of infection. Th17 cells may be crucial for the resolution of the disease & provide long lasting protective memory. We hypothesize that the infection with B. pertussis inhibits αvβ8 expression on lung DCs which limits active TGF-β leading to a limited cytokine environment that supports Th17 differentiation & thus prolongs the course of disease. We show there is an increase in the frequency of the conventional CD11b+ DCs & pDCs & a reduced frequency of CD103+ cDCs in lung of mice infected with B. pertussis. However data at days 5, 10 & 15 post B. pertussis infection show a decreased frequency of expression of αvβ8 on lung CD11b+ cDC, early post infection(p.i.), while showing an increased frequency of expression of αvβ8 on pDCs at 10 days & later p.i. CD11b+ cells are the majority of antigen presenting cells that contribute to Th17 differentiation. We suggest that the reduced expression of αvβ8 may impede the rapid mounting of Th17 immune responses p.i. Our results hint that although pDCs comprise a small percentage of lung DCs, upon maturation, they may contribute to Th17 differentiation through supporting the activation of TGF-β. Understanding how B. pertussis & its virulence factors alters the immune systems response to the infection can help us develop an improved pertussis vaccine.
Poster #: 59
Project Title: Inhibition of AAC(6’)-Ib-mediated resistance to aminoglycosides by copper
Author List:
Chiem, Kevin; Graduate, Biological Science, California State University, Fullerton, Presenting Author, Eden Award Finalist
Lin, David; Graduate, Biological Science, California State University, Fullerton
Fuentes, Brooke; Undergraduate, Biological Science, California State University, Fullerton
Jackson, Alexis; Graduate, Biological Science, California State University, Fullerton
Tran, Tung; Staff, Biological Science, California State University, Fullerton
Tolmasky, Marcelo; Faculty, Biological Science, California State University, Fullerton
Abstract: Background: Aminoglycosides are mainly used in the treatment of serious Gram-negative infections. However, their efficacy has been seriously reduced by the increase in resistant strains that produce aminoglycoside modifying enzymes such as the AAC(6′)-Ib (aminoglycoside 6′-N-acetyltransferase type Ib). Development of inhibitors of this enzyme that could be combined with aminoglycosides could help restore treatment efficacy. Methods: Growth curves were carried out measuring OD600 using a microplate reader. Cultures included varying concentrations of inhibitor and/or antibiotic. In vitro acetylation activity was measured using a 5,5′- dithiobis(2-nitrobenzoic acid)-based colorimetric assay. Results: Analysis of the action of cations on the acetylation reaction showed that CuCl2 is an inhibitor of AAC(6’)-Ib with an IC50 of 6 μM when measuring acetylation of amikacin. Acetylation of other aminoglycoside substrates was also strongly inhibited by CuCl2. Addition of 0.5 mM CuCl2 to the growth culture containing 8 μg/ml amikacin inhibited the growth of A. baumannii harboring aac(6’)-Ib. However, when the ionophore pyrithione in complex with Cu2+ was added to the cultures, the concentration required to make the cells susceptible to 8 μg/ml amikacin was 2 μM. Conclusions: Cu2+ is an efficient inhibitor of the acetylating reaction catalyzed by AAC(6’)-Ib. The relevance of this inhibition is illustrated by the suppression of resistance observed when adding copper-pyrithione to a culture of a clinical A. baumannii harboring the aac(6’)-Ib gene. Pyrithione in complex with copper could be developed to treat certain resistant infections in combination with aminoglycosides.
Grant support: CSUPERB Joint Ventures, NIH NIAID 2R15AI047115, NIH MHIRT 5T37MD001368
Poster #: 60
Project Title: Characterization of the mechanism of bacterial entry into brain endothelium
Author List:
Cutting, Andy; Graduate, Biology, San Diego State University, Presenting Author
Rodriguez, Anthony; Undergraduate, Biology, San Diego State University
Doran, Kelly; Faculty, Biology, San Diego State University
Abstract: Group B Streptococcus (GBS) is an important neonatal pathogen because of its ability to cross the blood-brain barrier (BBB) and cause meningitis. Infectious entry of GBS into brain microvascular endothelial cells (BMEC), the single cell layer that constitutes the majority of the BBB, is an important first step to the pathogenesis of disease. Previous results have demonstrated that GBS can directly enter BMEC, however, the host cell factors involved in bacterial endocytosis are not known. It has been reported that various microbes utilize clathrin- or caveolin-mediated mechanisms. Therefore we assessed the level of GBS invasion of BMEC in the presence of specific inhibitors. Our results demonstrate that inhibition of clathrin-mediated endocytosis, through disruption of the essential protein dynamin, resulted in decreased bacterial invasion. We next sought to investigate the role of key autophagy related protein, ATG16L1, known to interact with clathrin coated vesicles and be involved in autophagy activation. Immunofluorescence studies revealed that ATG16L1 co-localizes with intracellular GBS and inhibition of clathrin-mediated endocytosis abolished this interaction. To determine if ATG16L1 is necessary for GBS entry, we employed CRISPR (clustered regularly interspaced short palindromic repeat) mediated genomic editing to disrupt ATG16L1 in brain endothelial cells. CRISPR based genomic editing derives from harnessing bacterial adaptive immunity to specifically recognize specific sequences of DNA to facilitate site-specific cleavage. This concept has been applied to mammalian cell systems to edit certain sequences to manipulate genetic information. We utilized this technology and cloned a CRISPR based vector directed toward ATG16L1. Following successful transfection and clonal selection we confirmed that we created an ATG16L1 deficient brain endothelial cell line. Our results show that while GBS readily attached to ATG16L1 deficient cells, bacterial entry was significantly reduced compared to that observed in WT BMEC. Together our results suggest that clathrin- and ATG16L1-mediated entry is important for GBS invasion into brain endothelium. Future studies will aim to further characterize the role of ATG16L1 during GBS invasion and intracellular trafficking, as well as how this protein interacts with inflammatory signaling cascades in the context of bacterial meningitis.
Poster #: 61
Project Title: Combination Aspf3, Aspf9 and Hemolysin Liposomal Vaccines Provide Protection Against an Immunosuppressed Murine Pulmonary Aspergillus Challenge
Author List:
Gilkes, Adrienne; Graduate, Biology, California State Polytechnic University, Pomona, Presenting Author
Adler-Moore, Jill; Faculty, Biology, California State Polytechnic University, Pomona
Farah, Pamela; Undergraduate, Biology, California State Polytechnic University, Pomona
Olson, Jon; Faculty, Biology, California State Polytechnic University, Pomona
Ernst, William; Molecular Express Inc.
Fujii, Gary; Molecular Express, Inc.
Abstract: oduction: Aspergillus fumigatus causes approximately 90% of all human pulmonary mycoses and mortality exceeds 50% in immunosuppressed patients, supporting the need for an Aspergillus vaccine. We tested the efficacy of liposomal vaccines containing Aspf3 (A3), Aspf9 (A9) and Hemolysin (He) proteins conjugated to VesiVax® Conjugatable Adjuvant Lipid Vesicles (CALV) with the adjuvant monophosphoryl lipid A (MPL).
Methods: Recombinant A3, A9 and He proteins were conjugated to three separate CALV preparations via maleimide. In Study 1 (St1), a combination of A3, A9 and He liposomes (CALV-3Asp) at 5, 10 or 25ug of each protein/dose were compared with buffer controls in a lethal challenge. In Study 2 (St2), CALV-3Asp or A9 and He (CALV-2Asp) vaccines at 5 or 10ug of each protein/dose were compared with CALV without protein or MPL in a sublethal challenge. Mice were given a subcutaneous prime and 2 intranasal (IN) boosts, 2 or 3 wks apart. Two wks after the last boost, mice were immunosuppressed with triamcinolone and challenged IN with 8x10ex6 A. fumigatus conidia. Lungs were collected d1 (St1) or d3 (St2) post-challenge (n=6-7/gp), homogenized, and plated for CFU/g. In St1, lung homogenates were evaluated by Luminex multi-bead cytokine analysis and remaining mice (n=9-10/gp) were monitored for survival for 2 wks.
Results: Vaccination with CALV-3Asp (St1) markedly improved survival (5ug = 70%, 10ug = 50%, 25ug = 56%) compared to buffer controls (30% survival) and mice given 5ug of each protein had significantly lower lung fungal burden compared to control (5ug=1.0X10ex5 vs PBS=6.2X10ex5 CFU/g, P < 0.03). Cytokine analysis showed that infected lungs had higher levels of interferon-gamma (IFN-gamma) (P Conclusions: Vaccination with CALV-2Asp or CALV-3Asp vaccines was protective, enhancing survival and significantly lowering lung fungal burden with elevation of both IFN-gamma and IL-4 (St1). These results indicated that vaccination with A9 and He with or without A3, conjugated to CALV, stimulated both Th1 and Th2 responses with potential to contribute to protection against pulmonary aspergillosis.
Poster #: 62
Project Title: The effect of obesity on muscle stretch receptor function
Author List:
Shamai, Krystle N.; Graduate, Biological Sciences, San José State University, Presenting Author, Eden Award Finalist
Zaytseva, Dasha; Undergraduate, Biological Sciences, San José State University
Wilkinson, Katherine A.; Faculty, Biological Sciences, San José State University
Abstract: Postural instability, gait abnormalities, and mobility impairments have all been associated with obesity. Obesity leads to chronic low level systemic inflammation. As inflammatory factors have been shown to alter the activity of Group Ia/II muscle stretch receptors, we hypothesized that obesity would lead to a reduced response to stretch from muscle stretch receptor afferents (Delliaux et al., 2009). To determine if diet-induced obesity can alter the firing properties of muscle stretch receptor afferents, five-week-old male C57Bl/6 mice were fed either a high fat diet (HFD [60% kcal from fat]) or a control diet (10% kcal from fat) for 10 weeks. The extensor digitorum longus muscle and innervating sciatic nerve were dissected and placed into a perfused and oxygenated tissue bath. Muscle stretch receptor activity was recorded during ramp and hold stretches at increasing stretch lengths (2.5%, 5%, and 7.5% of optimal resting muscle length at which muscle can produce maximum force [L₀]) and speeds (20%L₀/sec, 40%L₀/sec, and 60%L₀/sec). Muscle stretch receptor firing frequencies increased linearly in both HFD and control groups in response to increasing stretch lengths, which is typical of muscle stretch receptors. Obese mice exhibited a decreased response to stretch, though, suggesting that improper proprioceptive information from the periphery is reaching the central nervous system. Decreased sensitivity of muscle stretch receptors may at least partially explain the balance impairment seen in obesity.
This work was supported by a CSUPERB New Investigator Grant (KAW) and a Department of Biological Sciences Research Fellowship (KS).
Poster #: 63
Project Title: Development of a Novel Larval Zebrafish Model of Streptococcal Infection
Author List:
Hancock, Bryan ; Graduate, Biology, San Diego State University, Presenting Author
Reyes, Efren; Undergraduate, Biology, San Diego State University
Del Cid, Natasha ; UCSD
Traver, David; UCSD
Doran, Kelly; Faculty, Biology, San Diego State University
Abstract: Streptococcus agalactiae, also known as Group B Streptococcus (GBS), is a blood-borne pathogen that causes a variety of disease states in humans including bacteremia, sepsis, and meningitis, and is also an emerging pathogen in aquaculture. Currently GBS is the leading cause of meningitis in the newborn resulting in significant morbidity and mortality. Blood-borne bacteria must penetrate the blood-brain barrier (BBB) in order to initiate disease. Although studies using tissue culture and small animal challenge models have enhanced our understanding of the molecular pathogenesis of GBS disease, limitations exist in live imaging and tracking of disease progression in real time. Over the last decade, zebrafish (Danio rerio) have emerged as a valuable tool for modeling a number of human diseases. Zebrafish are easy to genetically manipulate, lay large clutches, and are transparent for the first week of life. Additionally, the zebrafish and mammalian innate immune systems are striking similar. We have developed a larval zebrafish model of GBS infection to study bacterial and host factors that contribute to disease progression. Here we examine GBS infection in zebrafish larvae at three days post fertilization (dpf). GBS infection resulted in dose dependent larval death, a multiplicity of infection (MOI) of 102 CFU represented an LD50, and an MOI of 103 CFU resulted in 100% larval death by 36 hours. We also tested multiple GBS serotypes associated with disease and found that the hypervirulent GBS serotype III strain was the most virulent. Virulence was dependent on the presence of the GBS capsule, surface anchored lipotechoic acid (LTA) and toxin production, as infection with GBS mutants lacking these factors resulted in little to no mortality. Additionally, interleukin-1IL-1-and CXCL-8 were significantly induced following GBS infection compared to controls, suggesting that zebrafish larvae respond in a similar fashion as mice to GBS infection during disease. To further examine if GBS is able to cross the BBB of zebrafish larvae, we infected transgenic larvae, in which the endothelium is labeled with mCherry, with GFP expressing GBS. At 24 and 48hrs post infection we observed GBS within and outside of the brain vasculature, suggesting GBS penetration into the brain during the course of infection. Together, our results recapitulate findings of GBS infection in mice, and demonstrate that zebrafish larvae are a valuable model organism to study GBS pathogenesis.
Poster #: 64
Project Title: Bacterial Infection and Activation of Human Astrocytes
Author List:
Weston, Thomas; Graduate, Biology, San Diego State University, Presenting Author
Stoner, Terri; Postdoc, Biology, San Diego State University
Doran, Kelly; Faculty, Biology, San Diego State University
Abstract: The blood-brain barrier (BBB) is primarily composed of a single layer of specialized brain microvascular endothelial cells (BMEC), and together with astrocytes, pericytes, neurons and the extracellular matrix, constitute the neurovascular unit (NVU). The BBB functions to protect the brain from circulating toxins and microbial infection by maintaining extremely tight intracellular junctions and prohibiting pinocytosis. Astrocytes encircle BMEC with their pseudopodia and maintain direct contact with cerebrospinal capillaries. Several studies indicate that astrocytes help maintain BBB functions and are predicted to have an essential role in protection against microbial invasion, however, little is known about the role of astrocytes during the pathogenesis of bacterial meningitis. Here we examine the interaction of astrocytes with the leading neonatal meningeal pathogen, Group B Streptococcus (GBS). We used a well- characterized human fetal astrocyte cell line, SVG-A, and characterized GBS infection in vitro. We observed that all GBS strains of representative clinically dominant serotypes (Ia, Ib, III, and V) were able to adhere to and invade astrocytes. Cellular invasion was dependent on host actin cytoskeleton rearrangements, and was specific to GBS as the oral microbe, Streptococcus gordonii, failed to enter astrocytes. Analysis of isogenic mutant GBS strains deficient in various cell surface organelles showed that anchored lipoteichoic acid (LTA), serine-rich repeat protein (Srr1) and fibronectin binding (SfbA) proteins all contribute to host cell internalization. Wild-type GBS also displayed an ability to persist and survive within an intracellular compartment for at least 12 h following invasion. Moreover, GBS infection resulted in increased astrocyte transcription of proinflammatory factors such as interleukin (IL)-1β, IL-6, IL-36, growth signals such as VEGF, and motility signals such as MMP-2, MMP-9. Future studies will seek to determine the impact of these inflammatory mediators on BBB function. Understanding the role of astrocytes and the NVU during bacterial infection will provide important information regarding BBB disruption and the development of neonatal meningitis.
Poster #: 65
Project Title: Comparable Protection Against Influenza Produced by M2e Liposomes Containing Synthetic Monophosphoryl Lipid A or Bacterial Monophosphoryl Lipid A
Author List:
Saperi, Amalia; Graduate, Biology, California State Polytechnic University, Pomona, Presenting Author, Eden Award Finalist
Adler-Moore, Jill; Faculty, Biology, California State Polytechnic University, Pomona
Chiang, Suming; Molecular Express Inc.
Abstract: Introduction: We have previously shown that the adjuvant, bacterial Monophosphoryl Lipid A (B-MPL) and M2eHD (50ug/dose, HD=hydrophobic domain) in a liposomal vaccine elicited a protective immune response against influenza in mice. In this study, we examined the protection against influenza using a synthetic MPL (S-MPL) versus B-MPL in the M2eHD liposomes.
Methods: Groups (Gp) of female BALB/c mice (n=22/gp) were vaccinated with liposomes (L) d0 (subcutaneously), and intranasally (i.n.) d28 and d56: Gp1, L-M2e-HD + 5ug S-MPL; Gp2, L-M2e-HD + 15ug S-MPL; Gp 3, L-M2e-HD + 50ug S-MPL; Gp 4, L- M2e-HD + 15ug B-MPL; Gp 5, L-M2e-HD; Gp 6, L-5ug S-MPL; Gp 7, L-25 ug S-MPL; Gp 8, L-MPL. Sera and spleens (7 mice/Gp) were collected d60 and remaining mice (15 mice/Gp) challenged d69 with 10X LD50 PR8 H1N1 Influenza A. Lungs were collected (5 mice/Gp) d75 for viral burden (foci assay). Remaining mice (10/Gp) were monitored for morbidity to d97. M2e stimulated splenocytes were tested for cytokines by the Luminex cytokine assay. Sera were tested for virus precipitation antibody titer (ppt Ab) and anti-M2e IgG isotype concentrations.
Results: Liposomes with M2eHD (50ug) and S-MPL (15 or 25ug/dose) or B-MPL(15ug/dose) provided the most protection (90-100% survival) (P<0.04), produced the least weight loss (P<0.01) and the least disease signs (P<0.002), and significantly reduced the lung viral burden (P<0.01). These liposomes also elicited significantly higher ppt Ab versus controls (P<0.002). Anti-M2e IgG1 (Th2 response) and anti-M2e IgG2a (Th1 response) were elevated for all groups with M2eHD and 5ug, 10ug or 25ug S-MPL or B-MPL (15ug) versus controls (P<0.04). However, IFN-gamma (Th1 response), IL-4 (Th2 response) and IL-10 cytokine levels were significantly higher for the L-M2e-HD + 15ug B-MPL group compared to all other groups (P Conclusions: Based on increased survival, less weight loss and disease signs, lower lung viral burden and higher ppt Ab, M2eHD liposomes with 15 or 25ug/dose S-MPL or 15ug B- MPL adjuvants were comparably protective. Since the lowest dose of S-MPL (5ug) was not as effective, the results indicated that the response to S-MPL was dose dependent. Although the anti-M2e IgG isotyping results indicated that both adjuvants stimulated a Th1 and Th2 response, the cytokine data showed that L-M2eHD + B-MPL produced significantly more Th1 and Th2 cytokines than the L-M2eHD + S-MPL.
Poster #: 66
Project Title: HIV-1 Nef protein induces TNT formation in macrophages by up-regulation of Myo10.
Author List:
Gujarathi, Shivalee; Graduate, Biology (Biotechnology Program), California State University, Fresno, Presenting Author
Gousset, Karine; Faculty, Biology, California State University, Fresno
Abstract: Tunneling nanotubes (TNTs), transient, long, actin-rich projections, are a recently discovered mechanism for long-distance intercellular communication. TNTs are known to readily form between a wide variety of immune cells, including macrophages, as well as in neurons and glial cells. Recent studies using T-cells and B-cells suggested that Nef (Negative Regulation Factor), a 27 kDa myristoylated protein encoded by primate lentiviruses such as HIV-1 virus, induces protrusion formation, thereby contributing to cell-to-cell spread of viral infection. We have recently shown that Myosin X (Myo10), an unconventional actin molecular protein, stimulates TNT formation in neuronal cells (Gousset et al. 2013). Nef expression alone was also shown to induce similar structures in wild-type HIV-1 infected cells (Nobile et al. 2010). But, exactly how Nef promotes TNT function, and what role it actually plays in TNT formation is still unknown. Here we investigated the effects of Nef on nanotube formation in macrophages, which are important targets during HIV-1 pathogenesis. Determining the mechanism of TNT formation (i.e Myo10-dependent or ñindependent) will be critical in understanding the role of Nef and TNTs in virus-host interaction. We obtained a murine macrophage (RAW 264.7-N5) cell line that is stably transfected with pSC Nef 51 to produce low levels of Nef. N5 cells can be specifically induced with cadmium chloride overnight to express high levels of Nef. By western blot analyses, we analyzed Nef expression in N5 cells compared to wild-type macrophages (RAW 264.7) and confirmed its over-expression upon cadmium chloride treatment. Our results showed that induction in Nef expression correlates with an increase in Myo10 expression. High Nef expression also results in an increase in filopodia and TNT numbers, as observed by fluorescence microscopy. Finally,we are investigating if Nef-induced TNTs are functional (ability to transfer materials). Overall, these data suggest that Nef expression regulates the levels of Myo10 in macrophages, resulting in a profound effect on the formation of filopodia and TNTs. These experiments are the first steps toward elucidating Nef mechanism of action in TNT formation.
This project is supported by the National Institute Of General Medical Sciences of the National Institutes of Health under Award Number SC2GM111144. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.
Poster #: 67
Project Title: Expression and Physiological Characteristics of Autotransporter proteins in Probiotic Escherichia coli Nissle 1917
Author List:
Abdulrahim, Maha; Graduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Lane, Taylor; Graduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Stathopoulos, Christos; Faculty, Biological Sciences, California State Polytechnic University, Pomona
Abstract: Probiotics are live microorganisms that can provide beneficial effects to their host. Escherichia coli Nissle 1917 (EcN) is a probiotic strain that establishes persistent colonization of the intestine and is used to prevent or treat a variety of gastrointestinal disorders in humans and animals. However, the mechanisms for its probiotic effects remain unknown. Gram-negative bacteria utilize a highly efficient mechanism for extracellular secretion of large-size proteins, known as autotransporter or Type V secretion. Autotransporter proteins contribute to a variety of physiological functions in both commensal and pathogenic bacterial species, including nutrient uptake, adherence, biofilm formation, motility, immune modulation, and cytotoxic effects. Bioinformatical analyses were done to identify putative autotransporter proteins in the EcN genome and the genome of its closely-related organism uropathogenic E. coli CFT073. Our analyses showed that eleven autotransporter proteins are found in both the EcN and CFT073 genomes. Using immunoblotting, we have confirmed the expression of at least four autotransporter proteins of EcN: Ag43a, PicU, Sat, and Tsh/Vat. Biochemical assays have confirmed that secreted PicU, Sat, and Tsh/Vat are functional proteins. In addition, we have constructed three knockout mutants of ecN for autotransporter genes ag43a, picU, and sat. Biofilm formation assays have shown that wild type EcN is extremely efficient in producing biofilms in vitro. Testing the three knockout mutants in the same biofilm assays revealed that PicU and Sat contribute significantly to the formation of biofilms by EcN. This study represents the first analysis of the expression, function and role of autotransporter proteins in probiotic bacteria.
Poster #: 68
Project Title: Mode of Action of a Novel Anthelmintic Compound in C. elegans Nematodes
Author List:
Mojica, Brenda; Undergraduate, Biology, California State University, Northridge, Presenting Author
Hong, Ray; Faculty, Biology, California State University, Northridge
Abstract: People and animals around the world are affected by parasitic nematodes (helminthes), but most lack access to proper treatment. To increase drug compounds available to combat nematode parasites, such as filarial nematodes prevalent in tropical regions, we used the model organism Caenorhabditis elegans to identify potential drug targets of a novel drug ANX1. Specifically, we look for C. elegans mutants resistant to the nematocidal drug ANX1 by random EMS mutagenesis. We picked 3572 mutagenized F1 worms from two mutagenesis and followed up on 48 possible candidates. Next, we successfully outcrossed three of the most resistant mutant lines for further characterization for resistance to other similar nematocidal compounds and for genetic mapping. Two of the three mutants show dauer-constitutive phenotype, in which well-fed larvae switch to the non-reproductive dauer pathway, suggesting genes in dauer development are potential drug targets. Ultimately, positional mapping and cloning will help us identify the actual genes required for ANX1 susceptibility. By identifying the genes responsible for susceptibility and characterizing the responses of these mutants to variants of the ANX1 compound, we will aid the future designs of similar anti-helminthic compounds.
The project was funded by the CSUPERB Entrepreneurial Joint Venture Matching Grant program.
Poster #: 69
Project Title: Mesenchymal Stem Cells as a Vaccination Platform for Bordetella pertussis
Author List:
Llontop, Peter; Undergraduate, biology, San José State University, Presenting Author
You, Hana; Staff, Biology, San José State University
JImena, Andrew; Graduate, biology, San José State University
Abstract: Bordetella pertussis (B. pertussis) is the primary agent of whooping cough. An acellular vaccine is currently being used worldwide with temporary and reduced efficacy. Infants that did not yet develop an immune response to B. pertussis may suffer a fatal disease due to exposure to infected adults immunized with the current vaccine, suggesting a compromised protection. The goal of this project is to develop an effective method of vaccination against B. pertussis. Mesenchymal Stem Cells (MSC) has been well documented to display pleiotropic characteristics, such as immunosuppressive activity, yet are capable of antigen presentation and induction of specific immune responses.
In this project, we will test the hypothesis that murine (mouse) MSCs derived from adipose tissue and bone marrow can be used as a vehicle for antigen presentation, triggering specific cell-mediated immune responses to B. pertussis. This could be due to up-regulation of the antigen presenting characteristics of MSCs by treatment with the cytokine IFN-γ (Interferon gamma) and their immunosuppressive qualities that may prevent rejection.
The project will be divided into three stages: 1) Induce antigen presenting molecules via treatment with IFN-y and characterization of MSCs. This approach is based on the documentation demonstrating MSCs treated with IFN-γ display an increased expression of antigen presenting molecules such as MHC (Major Histocompatibility Complex) class II. 2) In vitro verification of T cell stimulation by MSCs pulsed with B. pertussis antigens. 3) Naïve mice will be immunized with the MSC presenting Bordetella pertussis antigens. We will then verify if a subsequent bacterial challenge is successfully prevented.
Characterization of the MSCs was conducted using an immunofluorescence assay (IFA) and by flow cytometry. We show that MSCs derived from fat and bone marrow that were pretreated with 100ng/mL IFN-γ resulted in about 12-20% increase in the number of cells expressing MHC class II. Preliminary results show heat-killed B. pertussis antigen was successfully pulsed onto the MHC class II molecules on the cultured MSCs induced by treatment with IFN-γ. Mice were immunized 3 times with 105 MSCs pulsed in one week intervals. No morbidity was detected in immunized mice.
We anticipate our current findings and overall outcome of this project may provide a novel approach to vaccine design and perhaps be used to prevent the reemergence of whooping cough.
Poster #: 70
Project Title: Evaluation of heteroaromatic curcumin analogues as effective antimicrobial agents
Author List:
Hartanto, Samantha; Undergraduate, Biology, California State University, Fresno, Presenting Author
Wang, Rubing; Postdoc, Chemistry, California State University, Fresno
Chen, Qiao-Hong; Faculty, Chemistry, California State University, Fresno
Rawat, Mamta; Faculty, Biology, California State University, Fresno
Abstract: Curcumin is a naturally-occurring polyphenol derived from the roots of the Curcuma longa plant, colloquially known as turmeric. Turmeric has long been used in traditional Asian medicine to treat a variety of ailments, including digestive, respiratory, and skin problems. As bacterial pathogens are rapidly becoming resistant to current antibiotics, the interest in curcumin’s potential as an antimicrobial agent has been especially piqued. However, pharmaceutical applications of curcumin have been hampered by its low bioavailability and fast in vivo metabolism into less-efficient byproducts. Therefore, it is of interest to remodel the structure of curcumin in order to improve bioavailability and therapeutic efficacy. This study focuses on the antimicrobial properties of curcumin and curcumin analogues. The analogues tested differ from curcumin in that they have the metabolically vulnerable diketone central backbone replaced by monoketone, piperidone, or cyclohexanone linkers. Using disk assays and broth microdilution method, curcumin and curcumin analogues were tested on Escherichia coli O157:H7, E. coli ATCC 25922, Salmonella serotype Enteritidis, Pseudomonas aeruginosa ATCC 10145, Staphylococcus aureus USA300_FPR3757 JE2, Enterococcus faecalis ATCC 29212, and Mycobacterium smegmatis mc2155. The minimum inhibitory concentrations (MICs) of the analogues were found to be equal to or lower than that of curcumin against all strains, indicating that the analogues were just as or more efficient at inhibiting bacterial growth than curcumin itself. A number of reports have indicated that curcumin is detoxified in a glutathione dependent manner. To determine if this was the case with Staphylococcus aureus and Mycobacterium smegmatis, mutants lacking the glutathione analogs, bacillithiol in Staphylococcus aureus and mycothiol in Mycobacterium smegmatis, were tested for susceptibility to these curcumin analogures. Our results indicate that there was no significant difference in MICs between the strains lacking thiols and wild-type. These results present promising support for the manipulation of curcumin’s chemical structure as a method to optimize the antimicrobial effects of curcumin
This work was made possible through funding from California State University, Fresno Associated Students Incorporated, NSF under Grant #HRD-1302873, Office of the Provost and the CSU.
Poster #: 71
Project Title: Oxidative stress in Staphylococcus aureus
Author List:
Thomas, Jason ; Undergraduate, Biology, California State University, Fresno, Presenting Author
Brooks, Teresa; Staff, Biology, California State University, Fresno
Rajkarnikar Singh, Arishma; Postdoc, Biology, California State University, Fresno
Rawat, Mamta; Faculty, Biology, California State University, Fresno
Abstract: Staphylococcus aureus is a human pathogen responsible for a broad spectrum of life-threatening infections, such as septicemia, endocarditis, toxic shock syndrome, and pneumonia. Furthermore, antibiotic resistance strains, such as methicillin resistant S. aureus (MRSA) that are responsible for not only nosocomial infections but a growing number of community acquired infections, are a cause of major concern. An understanding of how S. aureus is able to colonize and then survive in the human host is critical to the development of new strategies to prevent S. aureus infections. All pathogens including S. aureus must be able to cope with oxidative and nitrosative stress during infection as the immune system’s neutrophils and macrophages ingest the bacteria and produce microbicidal reactive oxygen and nitrogen species (ROS, RNS) to contain the infection. Additionally, S. aureus is confronted with ROS generated as byproducts of electron transfer reactions during aerobic respiration. One of the ways bacteria protect against oxidative stress is by using low-molecular-weight (LMW) thiols to reduce oxidants directly or indirectly, serving as electron donors to thiol peroxidases. In S. aureus, the main LMW thiol is bacillithiol (BSH) and we are thus studying the role of BSH and thiol peroxidases in the oxidative stress response. Specifically, we demonstrate that protein carbonylation and peroxidase activity is increased in the BSH lacking strains. We have also characterized the response of the wildtype strains and mutants disrupted in BSH biosynthesis treated with high levels of diamide, a thiol oxidant, using RNAseq. Our results demonstrate that certain thiol peroxidases increase in expression as a result of diamide treatment, perhaps as a way to compensate for the decrease in BSH. These results have been validated with quantitative real-time PCR. In addition, we are characterizing S. aureus thiol peroxidase mutants to determine if the reverse is true i.e BSH levels are elevated in the thiol peroxidase mutants. This research may help in understanding the different processes and mechanisms that are utilized by pathogens, like S. aureus, to protect against oxidative stress generated by neutrophils and macrophages and evade the immune response.
This research was funded by National Institutes of Health SC3 grant no. 5SC3GM100855-03 awarded to Dr. Mamta Rawat.
Poster #: 72
Project Title: Cost-effective ferret major histocompatibility complex class I genotyping combining Illumina and 454 pyrosequencing.
Author List:
Perry, Joseph; Graduate, Biology, California State University San Marcos, Presenting Author
Berry, Jessica; Staff, Biology, California State University San Marcos
Mothé, Bianca; Faculty, Biology, California State University San Marcos
Abstract: The domestic ferret (Mustela putorious furo) is a valuable asset for biomedical research, capable of modeling multiple pathologies such as cystic fibrosis, lung cancer, vascular disease and influenza. The relative low cost of housing, high fecundity, and similar susceptibility to human influenza strains make the ferret a preferred animal model for influenza vaccine studies. Current research attempts to create broadly effective vaccines incorporating adaptive cellular immune responses is stifled by the unknown repertoire of immune genes in the ferret biomedical population. Knowledge of the diversity in ferret major histocompatibility complex class I (MHC), which is crucial for T-cell recognition of infected cells, would permit cellular immune responses to be predicted. The time and cost involved in MHC identification strategies using Sanger sequencing technology serves as a deterrent to investigators seeking to study the allelic repertoire of animals currently in research. To meet the need of cost effective allele identification strategies, we successfully amplified and sequenced MHC class I alleles in one hundred ferrets through use of two next generation sequencing platforms, MiSeq and 454 pyrosequencing. These two platforms were selected for their capability to quickly sequence multiple animals simultaneously at an overall lower cost than Sanger sequencing. The animals sequenced originated from two different sources and are representative of ferrets used in biomedical studies in this country. From this endeavor, subsequent analytical protocols were developed in our laboratory to interpret the deep sequencing data. The analysis methods consisted of establishing read quality and trimming thresholds, while developing optimal allele construction algorithms to avoid calling false alleles as result of sequencing artifacts. The analysis resulted in 29 novel alleles being identified. Comparisons of the two technologies showed no significant difference in the ability to discover alleles; however analysis of 454 pyrosequencing data was less demanding in terms of hardware requirements than that of MiSeq data. In summary, we have developed next generating sequencing methods and analysis protocol to identify MHC class I alleles in ferrets. These MHC class I alleles can contribute to vaccine development and pathogenesis studies in macaques.
Poster #: 73
Project Title: Identification of a Bacterial Factor that Promotes Tight Junction Disruption in Brain Endothelium
Author List:
Bermudez, Andres; Undergraduate, Biology, San Diego State University, Presenting Author
Kim, Brandon; Graduate, Biology, San Diego State University
Doran, Kelly; Faculty, Biology, San Diego State University
Abstract: Group B Streptococcus (GBS) is a Gram-positive, encapsulated bacterium and a primary cause of meningitis in the newborn. In order for GBS to infect the central nervous system (CNS) and promote disease it must first interact with and penetrate a single layer of specialized brain microvascular endothelial cells (BMEC) which constitutes the majority of the blood brain barrier (BBB). These endothelial cells are bound together by tight-junction protein complexes that serve to keep the barrier intact and maintain proper BBB function. Previous and current work in our laboratory has demonstrated a loss of the BMEC tight junction components Occludin, Claudin-5, and ZO-1 in response to GBS infection. We have further identified a host transcriptional regulator, Snail-1, that is induced during GBS infection and is both necessary and sufficient to promote the loss of tight junction expression. We hypothesize that GBS possesses virulence factors responsible for activating Snail-1 leading to BBB disruption. To begin to assess this we incubated BMEC with live GBS or comparable amounts of bacteria that had been heat killed or formalin fixed, and measured transcript abundance of snail-1 compared to non-infected control. Interestingly, heat killed GBS did not stimulate snail-1 transcription, but formalin fixed GBS resulted in similar snail-1 transcript levels as live GBS, suggesting that induction may be due to the presence of a surface associated bacterial factor. We next prepared a GBS cell wall extract and showed that the extract is sufficient to induce snail-1 transcription. Consistent with these results we observed that treatment of BMEC with an agonist of Toll-Like receptor (TLR)-2 also resulted in a dose dependent stimulation of snail-1 transcript. TLR2 on host cells is known to recognize cell-wall components such as peptidoglycan, lipoteichoic acid (LTA) and lipoprotein from Gram-positive bacteria. We are currently using size exclusion chromatography on the GBS cell wall extract to determine the exact cell wall component responsible for Snail-1 induction. Future studies aim to continue this analysis and determine the TLR2 mediated signaling pathways that lead to activation of Snail-1 and subsequent disruption of tight junction components. Further examination of the mechanisms by which GBS promotes BBB disruption will provide a better understanding of the pathogenesis of GBS meningitis, and the possible development of therapeutic interventions.
Poster #: 74
Project Title: Developing new tools for studying ion physiology in protozoan parasites
Author List:
Barrera, Patricia ; Postdoc, Biological Science, California State University, Fullerton
Dave, Noopur ; Graduate, Biological Science, California State University, Fullerton, Presenting Author
Jimenez Ortiz, Veronica; Faculty, Biological Science, California State University, Fullerton, Presenting Author
Abstract: Protozoan parasites are responsible for human and animal diseases including malaria, toxoplasmosis, and Chagas disease. They affect hundreds of millions worldwide and impose a significant burden for public health. In the U.S., over 60 million people are infected with protozoan parasites. No effective pharmacological therapy or vaccines are available for many of these infections, underscoring the need for developing new intervention methods based on rational drug design and selective targets. Is estimated that 300,000 people are living in the U.S. with Chagas disease, for the most part without proper diagnosis or treatment. T. cruzi, has a complex life cycle that develops in mammals and insect vectors. Throughout its life cycle, the parasite encounters dramatic changes in the composition, pH and osmolarity of the media. Is order to survive, the parasites must cope with extreme environmental changes in a fast and efficient way. Moreover, some of these stress conditions are triggers for parasite differentiation, driving the transition from non-infective to infective forms. Ion channels are key players in sensing and adaptation to environmental conditions in all types of cells. In protozoan parasites, motility, invasion, and infectivity are strongly dependent on ionic conditions. Surprisingly, little is known about the type and role of ion channels expressed in the parasites. This can be explained, by the technical difficulties. Small size, active motility and a strong subpellicular cytoskeleton make almost impossible the direct recording by conventional electrophysiology. To overcome these limitations, we have developed two methods of heterologous expression: one based on bacterial expression of recombinant proteins, purification and reconstitution in liposomes followed by single channel electrophysiological recording; the second consisting in in-vitro transcription of the gene of interest, cRNA injection in Xenopus laevis oocytes and two-electrode voltage clamp analysis. These methods allowed us to identify two new channels from T. cruzi, a non-selective cation channel involved in osmoregulation (TcCat) and a Calcium-Activated potassium channel (TcCAKC). These methods have provided a reliable and efficient tool for characterization of the biophysical properties of the channels and can be used for drug screening toward the identification of new therapeutic agents against the parasites.
This work was supported by NIAID-NIH grant R00AI101167.
Poster #: 75
Project Title: Assessing the functional overlap of ion homeostasis, pH regulation, and survival and infectivity in the human parasite Toxoplasma gondii.
Author List:
Salgado, Fernando; Undergraduate, Biological Sciences, California State University, Long Beach
Marquez, Marcela; Undergraduate, Biological Sciences, California State University, Long Beach
Gomez, Ramon; Undergraduate, Biological Sciences, California State University, Long Beach
Morales, Jennifer; Undergraduate, Biological Sciences, California State University, Long Beach
Pace, Douglas; Faculty, Biological Sciences, California State University, Long Beach, Presenting Author
Abstract: Toxoplasma gondii is a highly successful intracellular parasite due to its ability to infect any nucleated mammalian or avian cell. During the lytic cycle, where the parasite repeatedly invades, replicates, and egresses from destroyed cells, it must contend with dramatic shifts in its immediate ionic environment (intracellular vs. extracellular). T. gondii is endowed with several cationic exchangers, pumps, and channels, however it does not have a Na+,K+-ATPase pump, which makes it different from the host cells it parasitizes. We hypothesize that the parasite has unique and robust ion regulatory capabilities that functionally overlap with pH regulation and that disruption of these pathways will have significant impact on the parasite’s ability to survive during the extracellular stage. To test this, extracellular parasites were incubated in neutral and acidic buffers in which the presence/absence of sodium and potassium was manipulated. First, the proton extrusion and intracellular pH of parasites exposed to varying ionic conditions was evaluated using the pH-sensitive fluorescent probe, BCECF. Results showed significant interaction between intracellular pH homeostasis and extracellular ion composition (+/- Na+ and/or K+). To further understand the biological implications of these results, plaque assays were used to test parasite survival and invasion efficiency while being exposed to varying ionic/pH conditions. Our results show that parasite survival (as measured by the subsequent number of plaques formed during a 7-day grow out) is facilitated in a more neutral pH only when all necessary ions are present. Interestingly when acidic conditions were investigated, the Na+ free and choline buffers (removal of Na+ and K+) offered protection and increased parasite survival. Further experiments linking these findings to rates of proton extrusion, calcium regulation and parasite motility were then investigated and will be discussed in the context of homeostatic mechanisms during the extracellular stage. The data gathered through these studies demonstrates T. gondii’s tolerance and survival in extracellular environments and illuminates potential regulatory pathways that may be unique to the parasite and therefore provide future strategies of fighting infection of this ubiquitous parasite.
Poster #: 76
Project Title: Plasmacytoid Dendritic Cell-Derived IFNα Modulates Th17 Differentiation During Bordetella pertussis Infection in Mice
Author List:
Wu, Victoria; Graduate, Biology, San José State University
You, Hana; Staff, Biology, San José State University
Ferguson, Ryan ; Undergraduate, Biology, San José State University
Llontop, Peter; Graduate, biology, San José State University
Smith, Andrew; Graduate, biology, San José State University, Presenting Author
Abstract: Whooping cough, caused by Bordetella pertussis (B. pertussis), is a highly contagious respiratory disease. Recent studies have implicated a central role for Th17 cells in the immunity and resolution of the disease. In recent, emerging studies, type I interferon (IFN) has been documented to suppress Th17 differentiation and IL-17 production in vitro and in vivo. While type I IFN is well characterized as an anti-inflammatory cytokine, their inhibition of Th17 responses may provide an immunosuppressive effect for the host. Plasmacytoid dendritic cells (pDCs) have been recognized as the most potent producers of type I IFNs. Therefore, we test the hypothesis that the functions of pDCs can manipulate the rise of Th17 cells during infection in mice, which can lead to a delayed resolution of the infection.
A robust rise of Th17 cells in the lungs was not detected until 10 days post-infection (dpi). Earlier during infection, pDCs emerged 4-5-fold in the lungs, and IFNα-secreting pDCs also increased significantly. Exposure of B. pertussis-infected conventional dendritic cells and naïve T cells to varying concentrations of IFNα in vitro led ablation of the proliferation of Th17 cells. Furthermore, blocking IFNα production by pDCs in mice, in vivo, resulted in an earlier increase in Th17 cells during infection and a lower bacterial load. Altogether, this work provides evidence of an inhibitory role for pDC-derived IFNα in modulating Th17 responses during the early stages of B. pertussis infection, which can result in a longer-lasting disease.
Poster #: 77
Project Title: Screening for inhibitors of Dengue Virus prM cleavage
Author List:
Horta, Alexandra; Undergraduate, Biology, San Diego State University, Presenting Author
Reed, Connor; Graduate, Biology, San Diego State University, Presenting Author
Stolp, Zachary; Graduate, Biology, San Diego State University
Smurthwaite, Cameron; Staff, Biology, San Diego State University
Williams, Wesley; Graduate, Biology, San Diego State University
Dharmawan, Andre; Graduate, Biology, San Diego State University
Wolkowicz, Roland; Faculty, Biology, San Diego State University
Abstract: Dengue Virus (DenV) is a mosquito-borne RNA virus endemic to the tropics and subtropics and an emerging pathogen in the US. As many as 400 million people are infected by DenV each year, which results in Dengue Fever or in severe cases; Dengue Hemorrhagic Fever and Dengue Shock Syndrome. Currently, no available antiviral therapeutics or vaccine exists against DenV.
DenV life cycle is characterized by the release of the plus-stranded RNA genome into the cytoplasm upon cell entry. The genome is then translated into a single polypeptide which is embedded in the Endoplasmic Reticulum (ER) membrane such that portions of the proteome face the lumen while others the cytoplasmic face. The polypeptide is cleaved co- and post-translationally by the viral encoded protease on the cytoplasmic side and by host proteases on the luminal side. The classical secretory pathway (CSP) is exploited as part of the viral life cycle for maturation of viral proteins and transportation to the cell surface. The pre-membrane protein (prM) of DenV relies on this pathway, and its proteolysis into ‘pr’ and ‘M’, an inefficient process supposedly achieved by Furin, is known to be a critical step for the production of infectious progeny. Thus, inhibition of prM cleavage represents an attractive target for potential antivirals.
We thus decided to adapt our previously described assay that monitors cleavage of the HIV-1 envelope boundary as it travels through the CSP to the cleavage of the prM boundary. The assay is based on a protein scaffold that contains a signal sequence for translocation to the ER, the substrate under study flanked by the HA and FLAG tags and a transmembrane domain for anchoring at the cell surface. In such a way, the assay is designed to reveal whether cleavage occurred or not based on HA alone or HA and FLAG surface expression, respectively, as analyzed with fluorescent antibody staining. We have demonstrated the assay to be robust and clearly assess cleavage within the CSP during transport to the cell surface. The assay, stably expressed in cells through retroviral technology, was analyzed by flow cytometry and proved to be suitable for high throughput screening. In an effort to find a competitor against prM cleavage, we utilized the assay to screen a Prestwick Chemical Library of 1280 FDA approved compounds. Cherry picking and dose response hinted at a potential hit, further demonstrating the utility of the assay for the discovery of a novel class of antivirals.
Poster #: 78
Project Title: A dynamically localizing polyester modulates bacterial cell size in response to nutrient availability
Author List:
Wood, Shannon; Graduate, Biology, California State University, Northridge
Stott, Kristina; Graduate, Biology, California State University, Northridge
Vu, Son; Undergraduate, Biology, California State University, Northridge
Arvizu, Ignacio; Undergraduate, Biology, California State University, Northridge, Presenting Author
Nguyen, Bao; Graduate, Biology, California State University, Northridge, Presenting Author
Murray, Sean; Faculty, Biology, California State University, Northridge
Abstract: How organisms respond to starvation is poorly understood at the cellular level. This study uses the model organism Caulobacter crescentus, which evolved to survive long periods of starvation, to address this important question. To study this problem, we created a FabH-depletion strain to induce fatty acid starvation. In response to starvation various bacterial species produce a molecule known as (p)ppGpp, an intracellular signaling molecule, which is linked to their survival until nutrients become available. (p)ppGpp facilitates the expression of certain genes whose protein products are required to survive starvation. We discovered that accumulation of the carbon storage molecule (and biodegradable plastic) polyhydroxybutyrate (PHB) is (p)ppGpp-dependent. Using fluorescent microscopy we were able to show that PHB accumulates in a CtrA, PhaR, and (p)ppGpp-dependent manner within a localized region of the cell and modulates cell size in response to nutrient availability. Here we present a novel model for PHB production in response to fatty acid starvation in Caulobacter crescentus. (p)ppGpp is responsible for the expression of CtrA, which activates the expression of PhaR, which is required for PHB accumulation. Subsequently, PHB provides not only carbon for the survival of long-term starvation but a mechanism through which cells decrease size and thus nutrient requirements. Thus, our model reveals a four-component genetic pathway that explains PHB accumulation in response to fatty acid starvation.
This work was supported by NIH grant SC2 GM084860 and a CSUPERB Development grant to SRM, NIH R25 GM063787 to MariaElena Zavala in support of IA, and CSUN Interdisciplinary Research Institute in the Sciences Fellowships to KVS, SMW, and BTN.
Poster #: 79
Project Title: Understanding microalgal species composition and contributions in Antarctic glacial melt water through rbcL high throughput sequencing
Author List:
Barretto, Kathryn; Graduate, Biology, San Francisco State University, Presenting Author
Kalmbach, Andrew; Graduate, Biology, San Francisco State University
Carpenter, Edward; Faculty, Biology, San Francisco State University
Abstract: The McMurdo Dry Valleys (MDV) in Antarctica present unique research opportunities, both because of the relatively uncharacterized biogeochemical impact of their microbial communities, and because of their sensitivity to climate change. Despite harsh desiccation, pH, and salinity stress, summer glacial melt water supports life in the MDV in the form of microalgal mats. These mat communities are complex in structure and vary spatially. Due to this complexity, standard microscopy and sequencing approaches yield a limited understanding of community assemblages. High throughput sequencing by synthesis is necessary to truly understand the community structure. Our previous sequencing approaches focusing on 16S rRNA have profiled communities with understudied photosynthetic phyla such as Acidobacteria, Gemmatimonadetes, and Chloroflexi. We are interested in characterizing these phototrophic communities further by sequencing the rbcL gene, a 554bp sequence that encodes the large subunit of the ubiquitous photosynthetic protein RuBisCO. Use of rbcL will allow us to study phototrophic prokaryotes and eukaryotes with primers and workflow validated extensively in the literature. Initial screening of MDV algal mats has identified Form-ID rbcL in metagenomic samples, indicating the potential presence of α, β, and γ-Proteobacteria, Heterokonta, Rhodophyta, and Haptophyceae. Analysis of pooled assemblage genomic DNA has shown an average background (Guanine + Cytosine) content of 67.2%, indicating the presence of relatively high G+C species. Illumina high throughput sequencing of rbcL from metagenomic samples will yield further insight into the varying structure of these mat communities. We have seen that species composition shifts with soil wetness as a driver of oxic and anoxic conditions, and expect composition of photosynthetic prokaryotes and eukaryotes to behave similarly. We also expect assemblages to shift with pH and soil nutrients, as microalgal mats make a significant biogeochemical contribution to the MDV. Studying these organisms has the potential to elucidate unique cellular processes with biotechnological applications.
This work was conducted at the RTC Gene Lab, supported by RTC, NSF FSML Grant No. 0435044 and the SFSU College of Science and Engineering. Additional support by NSF Grant No. 10249000. Sequencing will be conducted at the Genomics/Transcriptomics Analysis Core, supported by SFSU COSE and Department of Biology.
Poster #: 80
Project Title: A potential role for ubiquitin in the regulation of poly(A) tail removal from messenger RNA (mRNA) in human cells
Author List:
Patel, Neha; Graduate, Biological Sciences, California Polytechnic State University, San Luis Obispo, Presenting Author
Spalding, Mara ; Undergraduate, Biological Sciences, California Polytechnic State University, San Luis Obispo, Presenting Author
Tun, Maria; Allan Hancock College
Dighe, Natasha; Undergraduate, Biological Sciences, California Polytechnic State University, San Luis Obispo
Parker, Greg; Graduate, Biological Sciences, California Polytechnic State University, San Luis Obispo
Pemberton, Crystal; Undergraduate, Biological Sciences, California Polytechnic State University, San Luis Obispo
Clement, Sandra; Faculty, Biological Sciences, California Polytechnic State University, San Luis Obispo
Abstract: The poly(A) tail of eukaryotic mRNAs is an essential post-transcriptional modification that enhances gene expression by stimulating translation and promoting stability of the message. Removal of this structure by deadenylation is often the first and rate-limiting step in mRNA decay, and occurs in a two- step process initiated by the Poly(A) Nuclease (Pan2) complex and completed by the Ccr4/Caf1/Not complex (1). The purpose of this study is to test the hypothesis that deadenylation by Pan2 is regulated by ubiquitin-dependent protein interactions mediated by the E3 ubiquitin ligase activity of Not4. The Pan2 protein contains a conserved domain belonging to a class of deubiquitinating enzymes, although the catalytic residues required for ubiquitin removal are not conserved. In order to determine whether Pan2 binds ubiquitin, cell lysates expressing epitope tagged Pan2 from transiently transfected Human Embryonic Kidney (HEK) 293T cells were incubated with agarose beads covalently linked to ubiquitin. We observed that Pan2 efficiently binds ubiquitin-agarose, but not agarose lacking ubuquitin. As further evidence for the specificity of the interaction between Pan2 and ubiquitin, incubation of cell lysates with excess amounts of free ubiquitin reduced the ability of Pan2 to associate with ubiquitin-agarose beads. In order to determine whether the Not4 E3 ubiquitin ligase activity is required to ubiquitinate protein targets of Pan2, we used the CRISPR/cas9 genomic editing system (2) to generate a functional knock out of the Not4 gene. HEK 293T cells were transfected with the dual-expression vector pX330 containing the Cas9 guide-RNA (gRNA) directed endonuclease as well as an expression cassette for the transcription of a 20 nucleotide gRNA targeting Exon 1 of the Not4 gene. Transfected cells were selected via puromycin resistance and genomic DNA from individual clones was isolated and screened for the presence of insertion/deletion mutations via loss of a restriction enzyme site. Experiments are currently underway to determine the consequence of the CRISPR/cas9 induced Not4 mutation on Not4 protein levels as well as to identify ubiquitin-dependent Pan2 binding partners.
References
1. Nat Struct Mol Biol 12, 1054-63 (2005)
2. Science 339(6121), 819-823 (2013)
Poster #: 81
Project Title: Wdr68 functions in a BMP-Edn1-Jag1b signaling network for craniofacial development in zebrafish
Author List:
Alvarado, Greg; Graduate, California State University, Los Angeles, Presenting Author
Whitman, Taryn; Graduate, California State University, Los Angeles, Presenting Author
Bhandari, Anish; Undergraduate, California State University, Los Angeles
Shang, Robin; Graduate, California State University, Los Angeles
Pham, Annie; Undergraduate, California State University, Los Angeles
Nissen, Robert; Faculty, California State University, Los Angeles
Abstract: Many craniofacial syndromes are caused by defects in signaling pathways that pattern the cranial neural crest cells (CNCCs) along the dorsal-ventral axis. For example, defects in Bone Morphogenetic Protein (BMP) signaling are associated with cleft lip/palate, auriculocondylar syndrome is caused by impaired Endothelin-1 (Edn1) signaling, and Alagille syndrome is caused by defects in Jagged-Notch signaling. The BMP, Edn1, and Jag1b pathways intersect because BMP signaling is required for ventral edn1 expression that, in turn, restricts jag1b to dorsal CNCC territory. Previously, we identified the wdr68 gene as essential for edn1 expression in the zebrafish. Here we show that wdr68 activity is required between the 17-somites and prim-5 stages through experiments using an inducible Tg(hsp70l:GFP-Wdr68) zebrafish line. This identified developmental window overlaps with the known onset of edn1 expression at the 18-somites stage. We additionally seek to determine which tissue requires Wdr68 activity through experiments using a GAL4-UAS driver-reporter system. We will present progress on generating an ectoderm-derived epidermis-specific Tg(krt4:Gal4-VP16) driver line and a Tg(UAS:GFP-Wdr68) reporter line. Crosses of these lines, plus a CNCC-specific Tg(Sox10:Gal4-VP16) driver line, will eventually allow us to determine if Wdr68 activity is required in the CNCCs or the surrounding ectoderm-derived pouch. Using in situ hybridization (ISH), we also report here that the expression patterns of jag1b, hey1, and grem2 as well as dlx1a, dlx2a, and pitx2 are altered in wdr68 mutant zebrafish. Together these data support a role for Wdr68 within the BMP-Edn1-Jag1b signaling hierarchy. Previous reports detected Wdr68 in physical complexes with multiple Smads, suggesting potential roles within BMP signaling. Here we further report pharmacogenetic interactions between wdr68 and modulators of BMP signaling using craniofacial cartilage and ISH readouts for edn1 expression. Strikingly, we found that the BMP agonist ISL could rescue lower jaw formation and edn1 expression in wdr68 mutants. BMP signaling is mediated by phosphorylated Smad1/5 transcription factors. We will also present progress towards IHC analysis of pSmad1/5 in wdr68 mutant zebrafish. This work is supported by grants from CSUPERB and the NIH-NIDCR.
Poster #: 82
Project Title: Developmental Changes in the Expression of Y Chromosome Genes in the Mouse Cortex and Hippocampus
Author List:
Dang, Alex; Undergraduate, Biological Sciences, California State University, Long Beach, Presenting Author
Armoskus, Chris; Graduate, Biological Sciences, California State University, Long Beach
Taniguchi, Saori; Graduate, Biological Sciences, California State University, Long Beach
Fulay, Lester; Undergraduate, Biological Sciences, California State University, Long Beach
Tsai, Houng-Wei; Faculty, Biological Sciences, California State University, Long Beach
Abstract: To elucidate the genetic mechanism that governs sex differences in cortical and hippocampal structures and neural circuits regulating distinct cognitive and social behaviors between the sexes, we used gene expression microarrays to identify 90 candidate genes differentially expressed in the neonatal cortex/hippocampus between male and female mice, including three genes, Ddx3y, Eif2s3y, and Kdm5d, located on the non-recombining region (NRY) of the Y chromosome. Since this region does not undergo recombination with the X chromosome, NRY genes are exclusively expressed in males and thus might be responsible for masculinization of brain development and behavior. Male-specific expression of NRY genes has been reported in the whole brain of embryonic, neonatal, and adult mice, but it still remains unclear if their levels change with age during development. In the present study, we hypothesize that expression of NRY genes is altered in the developing mouse cortex/hippocampus, which is critical for neural function and development in males. To test our hypothesis, we used reverse transcription with real-time polymerase chain reaction (RT-qPCR) to measure the mRNA levels of four NRY genes, Ddx3y, Eif2s3y, Kdm5d, and Uty, in the male and female mouse cortex/hippocampus collected at birth (PN0), 7 (PN7), 14(PN14), and 21 days (PN21) after birth. In consistent with the literature, the four NRY genes we measured were exclusively expressed in the male, but not female, cortex/hippocampus during early development. With further analysis of one-way ANOVA or the Kruskal-Wallis one-way ANOVA, we discovered significant changes in relative mRNA levels of these genes with age. For Ddx3y and Kdm5d, a significant rise in mRNA levels was observed in the males on PN21 when comparing to PN0. Similar to Ddx3y and Kdm5d, Uty expression significantly increased with age, but occurred on PN14 and PN21. In contrast, two transient elevations of Eif2s3y mRNA were found on PN7 and PN21. Our data demonstrate that, for the first time, expression of selected NRY genes in the mouse cortex/hippocampus is not only sex-specific, but also age-dependent. The age differences in selected NRY gene expression suggest, other than gonadal steroid hormones, possible mechanisms by which these genes may differentially participate in male brain development and function.
This work was supported by National Institutes of Health Grant SC3GM102051.
Poster #: 83
Project Title: Purification of Truncated Wild-Type and Mutant Recombinant Lipoprotein Lipase.
Author List:
Madhwani, Kimberly Rose; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Medh, Jheem; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Background: Lipoprotein lipase (LPL) catalyzes the hydrolysis of triglycerides in lipoprotein particles. The LPL molecule consists of two domains; a NH2-terminal domain with lipolytic activity, and a COOH-terminal domain that functions as an adapter between cell surface proteoglycans and apolipoproteins. Recently, we reported that silencing the LPL gene in THP-1 macrophages promotes the expression of ABCA1, an atheroprotective cholesterol transporter.
Objective: Our long-term goal is to identify the molecular components of LPL that contribute to its ability to modulate ABCA1 expression. The objective of this project is to synthesize recombinant LPLC, a truncated molecule lacking the catalytic domain; and LPLC-WW, a mutant carboxyl-terminal domain that is unable to bind lipoproteins.
Methods: pGEX-2T plasmids, containing the genes for the LPLC domain (WT and WW mutant) were used to prepare recombinant fusion proteins with a glutathione-S-transferase (GST) tag. pGEX-2T LPLC-WT and pGEX-2T-LPLC-WW plasmids were transformed into competent E.coli cells and plated on LB+ampicillin agar plates. Viable colonies were picked and inoculated into 200 ml cultures of 2X-YTA medium. The cultures were induced with 100 mM IPTG for 2-6 hours, pelleted and resuspended in PBS. Cells were sonicated at 37o for 10 minutes and solubilized in 20% Triton X-100. Glutathione Sepharose 4B was used to immobilize the GST fusion proteins while the contaminants were washed away with PBS. The fusion proteins were eluted from an aliquot of beads by Elution Buffer containing 10 mM Glutathione and the elution of GST-LPLC was confirmed by 15% SDS-PAGE. Next, a thrombin mixture was added to the Glutathione Sepharose 4B-bound fusion proteins, and incubated for 12-16 hours to cleave the LPLC proteins from the immobilized GST. The presence of purified LPLC proteins in the supernatant was confirmed by 15% SDS-PAGE and Coomassie Blue staining.
Results: Both LPLC-WT and LPLC-WW were purified free of any contaminants including GST. We obtained 106 μg of LPLC-WT and 117 μg of LPLC-WW.
Conclusions: The pGEX-2T plasmids are suitable for the preparation of GST fusion proteins. The use of thrombin and a glutathione-sepharose column efficiently removed the GST tag to obtain pure protein. The recombinant proteins will be used to determine the molecular elements of LPL required for regulation of ABCA1.
Acknowledgements: This work was supported by National Institutes of Health Award SC3GM095413.
Poster #: 84
Project Title: On the Hunt for Adult Stem Cells in Adult Drosophila melanogaster
Author List:
Villasenor, Teresa; Undergraduate, Biology, California State University, San Bernardino, Presenting Author
Ganther, Sean ; Undergraduate, Biology, California State University, San Bernardino, Presenting Author
Toomey, Channing ; Undergraduate, Biology
Hudson, Zakkary; Undergraduate, Biology, California State University, San Bernardino
Bournias-Vardiabasis, Nicole; Faculty, Biology, California State University, San Bernardino
Abstract: Oenocytes in adult Drosophila melanogaster function in lipid processing, storage and detoxification of substances in the body. They are analogous to hepatocytes (liver cells) in mammals, although we are finding that they do much more than their mammalian analogs. Adult Drosophila melanogaster have 52 cardiac cells that regulate heart tube function and rhythm. The importance of these two type of cells in the function and health of the animal lead us to believe that these tissues must contain adult stem cells as a source for the renewal and repair mechanisms needed to maintain these tissues. The hearts and oenocytes of zero to six day-old adult wild-type male Drosophila melanogaster were used. Heart and oenocyte explants were first performed to ensure the cells were viable in vitro. The cultures were set using a tissue micro-homogenizer or enzymatic digestion to establish which method would result in cell survival and proliferation in vitro. Schneider’s culture media with two percent antimycotic and 20 percent fetal calf serum was used. Successful explants of the heart tissue were maintained up to six days and remained beating for up to four days. Trypsinization proved to be too harsh on the heart tissue and a successful culture using trypsin as the homogenization method was not established. Successful proliferation of mechanically homogenized cardiomyocytes in culture suggests there may be stem cells in the heart tissue. Further studies of these proliferating cells utilizing immunocytochemistry and flow cytometry is needed to verify the presence of stem cells. Oenocyte explants were maintained up to six days. A successful oenocyte monolayer could not be established, possibly because of the difficulty associated with isolating and extracting them. Once identification of adult stem cells in these tissues is verified, a culture of pure adult stem cells could be established for future studies. This research was funded by the CSUSB Office of Student Research Summer Program. We would like to give a special thank you to Linda Sanderman, Kathleen Leon, and Eugene Tutunaru.
Poster #: 85
Project Title: The Role of Cellular Proliferation During Adipogenic Differentiation of Human Mesenchymal Stem Cells
Author List:
Alencastro, Frances ; Graduate, biology, California State Polytechnic University, Pomona
Marquez, Maribel; Graduate, biology, California State Polytechnic University, Pomona
Jimenez, Jossue; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Keagy, Laura; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Blanco, Giselle; Undergraduate, Biology, California State Polytechnic University, Pomona
Madrigal, Alma; Graduate, Biology, California State Polytechnic University, Pomona
Zhao, Yuanxiang; Faculty, Biology, California State Polytechnic University, Pomona
Abstract: Adipogenesis is the process in which uncommitted stem cells differentiate into mature adipocytes (fat cells). It has been widely accepted that mitotic clonal expansion/cellular proliferation is a pre-requisite for adipogenesis in murine cells. However, it is not clear whether this also holds true for human adipogenesis. We used human mesenchymal stem cells (hMSCs), a type of adult stem cell, as an in-vitro model to study human adipogenesis. Microarray studies identified a number of genes including a group of cell cycle regulators, which showed significant expression changes in response to exogenous adipogenic inducing media. Our research has focused on: 1) Validating gene expression changes identified from the microarray analysis by RT-PCR; 2) Examining cellular proliferation trends during early adipogenesis; and 3) Chaacterizing the functional roles of validated cell cycle genes in human adipogenesis. Our RT-PCR results confirmed the expression changes of 20 selected genes implicated in adipogenesis from previous microarray studies, including 6 cell cycle genes that were universally down regulated. Consistent with the expression data, cell proliferation was limited to the first 48hrs of adipogenic induction and subsequently inhibited. To address the role of cell proliferation during early adipogenesis, cell proliferation was either inhibited using siRNAs targeting specific cell cycle genes (CDK1, CDK2, CCND1 and CDK4), or enhanced by supplementing exogenous growth factor bFGF or insulin in a time course dependent manner. Inhibiting cell proliferation by siCDK1 during early adipogenic induction significantly reduced total cell numbers but increased the percentage of total fat cells compared to siControl, though siCDK2, siCCND1 and siCDK4 had no or modest enhancement effect. Stimulation of cell proliferation by bFGF or insulin on the other hand consistently increased total cell numbers but was only beneficial for adipogenesis when applied during the first 24hrs of adipogenic induction, likely by expanding the population of hMSCs that are capable but have not yet committed to the adipogenic lineage. Application at later time points had inhibitory effect on differentiation instead. Our results so far demonstrated that cell proliferation was not a pre-requisite for adipogenic initiation; rather its further inhibition by siCDK1 treatment could promote more efficient differentiation efficiency.
Poster #: 86
Project Title: THE ROLE OF RGS2 IN HUMAN ADIPOGENESIS AND OSTEOGENESIS
Author List:
Madrigal, Alma; Graduate, Biology, California State Polytechnic University, Pomona, Presenting Author
Zhao, Yuanxiang; Faculty, Biology, California State Polytechnic University, Pomona
Abstract: Human mesenchymal stem cells (hMSCs) are multipotent adult stem cells capable of giving rise to mesodermal tissues including bone, adipose, muscle and cartilage. These cells could be derived from bone marrow, adipose tissue or umbilical cord blood. In addition they can be expanded and differentiated in vitro into specific mature cell types upon receiving external stimuli. However, the cellular and molecular mechanisms underlying the induced differentiation are poorly understood. Better understanding will not only increase our basic knowledge of embryo development, but also has important clinical applications due to their vast therapeutic potential for an array of metabolic, cellular, and degenerative diseases. Through a unique microarray study comparing gene expression profiles between hMSCs undergoing adipogenesis and hMSCs control cells by using two distinct adipogenic differentiation approaches, a number of genes whose expression was significantly up- or down-regulated during adipogenesis was uncovered. In this study, we focus on understanding the role of a GTPase regulator, RGS2, in the differentiation and adipogenic and osteogenic lineage commitment of adipose-derived hMSCs. RGS2 is known to regulate cell signaling through GTP activity and has been implied to play a role in cell fate commitment. We have so far characterized RGS2 expression pattern by RT-PCR during both adipogenic and osteogenic differentiation of hMSCs at 12h, 24h, 36h, 48h, 72h, 96h, 5D, 6D, 7D and 16D post differentiation induction. Overall, RGS2 was up-regulated during both adipogenic and osteogenic induction but appear to oscillate in response to osteogenic media change at 48h invervals. Functional study of RGS2 during adipogenic and osteogenic differentiation is being carried out by loss (siRGS2 silencing) and gain (RGS2 overexpression) of function manipulation. Our preliminary results demonstrated that at up to 70-80% expression knock-down, siRGS2 did not have significant effect on hMSCs adipogenesis. Future studies will focus on the evaluation of the effect of siRGS2 in osteogenesis, as well as the effect of RGS2 overexpression in both adipogenesis and osteogenesis.
Poster #: 87
Project Title: A role for Lethal Giant Larvae and JNK activity in Neurosphere Formation and Anchorage-Independent Growth of Primary Neural Stem/ Progenitor Cells
Author List:
du Bois, Haley ; Undergraduate, Biological Sciences, Humboldt State University, Presenting Author
Meyers, Ian; Undergraduate, Biological Sciences, Humboldt State University, Presenting Author
Collins, Hannah; Undergraduate, Biological Sciences, Humboldt State University
Sprowles, Amy; Faculty, Biological Sciences
Abstract: High grade glioma are aggressive and highly invasive brain cancers which harbor stem cell like tumor propagating cells (Singh et al. 2004) and originate from neural stem/progenitor cells using genetically engineered mouse models (Alcantara Llaguno et al. 2009). Disrupted polarized cell divisions, increased self-renewal and impaired differentiation capacities characterize both human tumor propagating cells and murine cells of origin in glioma (Sugiarto et al. 2011). Recent evidence suggests the WD40 protein Lethal Giant Larvae (LGL) and c-Jun N-terminal kinases (JNK) may play an important role in regulating these properties. We hypothesized the loss of LGL would increase JNK activity to result in phenotypes associated with glioma precursors. Neuroblasts were isolated from adult Lgl loxp/loxp mice, treated with AD-CRE GFP or AD-GFP, and analyzed for neurosphere formation, anchorage-independent growth, and changes in JNK signaling. Our data shows treatment with either the JNK Inhibitor SP60012 or activator anisomycin reduces neurosphere size and formation. However, Lgl-/- cells do not show a significant increase in JNK phosphorylation by Western blot analysis. Lgl-/- cells do demonstrate a significant increase in soft agar colony formation that is further stimulated in the presence of 10 ng/ml anisomycin and resistant to reduced growth factor conditions. Interestingly, Lgl+/+ cells show dramatically reduced levels of nuclear cJun when cultured in the presence of 10 ng/ml anisomycin, while deletion of Lgl seems to stabilize this transcription factor. Though our data does not completely support our initial model, it does support a role of JNK and a correlation between cJun levels and anchorage independent growth. Further studies will examine regulation of cJun expression by other regulatory signaling cascades.
Poster #: 88
Project Title: Regulation of manganese oxidation in Erythrobacter SD-21
Author List:
Peterson, Justin; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Mao, Lucy; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Heymans, Rachel; Undergraduate, Biological Science, California State University, Fullerton
Johnson, Hope; Faculty, Biological Science, California State University, Fullerton
Abstract: Recent increases in industrialization have made it easier for toxic metals to accumulate in our water supply, posing a threat to our health and the environment. However, toxic heavy metal contamination may be cleaned up through the use of the oxidized transition metal, manganese. Manganese oxides are able to oxidize heavy metal toxins, often rendering them less toxic. The manganese (II) oxidizing peroxidase protein, encoded by the mopA gene in the alpha-proteobacterium Erythrobacter sp. SD-21, is responsible for oxidizing manganese (II) into its insoluble manganese (III and IV) oxide form. Erythrobacter sp. SD-21 was grown with and without manganese, cells were collected in stationary and exponential phase and manganese was added to determine the effect of manganese on mopA expression. Quantitative PCR (qPCR) was performed and analyzed using the Pfaffl method to determine if manganese caused an upregulation or downregulation of the mopA gene. Glyceraldehyde 3-phosphate dehydrogenase gene (gapdH) expression was used as the standard. We found that manganese does not control mopA expression during exponential phase. We are currently investigating the effect of manganese during stationary phase and comparing expression during stationary and exponential phases.
Acknowledgements: National Science Foundation, CSUF Incentive grant, CSUPERB.
Poster #: 89
Project Title: Characterization of Lanthanum-Dependent Methylotrophic Growth in Methylobacterium extorquens AM1
Author List:
Vu, Huong; Undergraduate, Biological Sciences, San José State University, Presenting Author
Subuyuj, Gabriel; Undergraduate, Biological Sciences, San José State University, Presenting Author
Vijayakumar, Srividhya; Graduate, Biological Sciences, San José State University
Skovran, Elizabeth; Faculty, Biological Sciences, San José State University
Abstract: Methylobacterium extorquens AM1 is a model organism for understanding methylotrophic growth, which is of particular interest due to its potential to produce value added chemicals such as bioplastics and biofuels from methanol. Although this organism has been studied for over 50 years, much is left to learn about the regulation of the metabolic pathways required for methylotrophy. During the first step of methanol metabolism, methanol is oxidized to formaldehyde in the periplasmic space by methanol dehydrogenase. In addition to the well-characterized calcium-dependent methanol dehydrogenase, MxaFI, XoxF can function as a methanol dehydrogenase when the rare earth element lanthanum is present. We show that expression from the mxaFI and xoxF1 promoters is oppositely controlled by exogenous lanthanum. In the absence of lanthanum, expression from the mxa promoter is high and expression from the xoxF1 promoter is low. When lanthanum is added, the opposite expression pattern is seen. Consistent with these data, loss of mxaF does not affect methanol growth if lanthanum is present in the medium whereas loss of xoxF1 results in a large growth defect, supporting the cofactor specificities of MxaF and XoxF1. In addition, the ability of an mxaF mutant to grow in methanol medium in the presence of additional lanthanides such as cerium, praseodymium and neodymium suggests that the cofactor specificity of XoxF1 is flexible. Surprisingly, an mxaF xoxF1 xoxF2 triple mutant strain is still able to grow in methanol medium containing lanthanum but at a reduced rate. This suggests the existence of yet another enzyme capable of methanol oxidation in the presence of lanthanum. Candidates for the novel methanol oxidation enzyme have been isolated using transposon mutagenesis. Further studies will be conducted to determine if the enzymes encoded by these genes contribute to methanol dehydrogenase activity during growth with lanthanum. A better understanding of how these methanol dehydrogenases are regulated will be important for optimization of strains and growth conditions for the synthesis of value added products from methanol. Funding for this project was provided by San José State University and CSUPERB.
Poster #: 90
Project Title: Developing a fluorescence resonance energy transfer (FRET) assay to identify novel activators of the Wnt/β-catenin pathway
Author List:
Quintino, Brooke; Undergraduate, Biology, California State University, Fullerton, Presenting Author
Ott, Christopher; Graduate, Biology, California State University, Fullerton
Patel, Nilay; Faculty, Biology, California State University, Fullerton
Abstract: The goal of this project is to develop an assay to study the protein-protein interaction of glycogen
synthase kinase-3β (GSK3β) and Axin. As a central developmental pathway in the body, the Wnt/β-
catenin pathway is important to the stem cell biology field. Additionally, this study is important to
the field of cancer biology as abnormalities in the Wnt/β-catenin pathway have been implicated in
the formation of gastrointestinal cancers. When GSK3β and Axin bind with several other proteins
they form a destruction complex that phosphorylates β-catenin and labels it for degradation. Binding
of Wnt protein to a cell surface receptor prevents formation of the destruction complex and allows
for accumulation of β-catenin in the cytoplasm. β -catenin is translocated to the nucleus where it
can activate specific target genes. Currently, activation of the canonical Wnt pathway is achieved by
inhibition of GSK3β. However, since GSK3β is involved in several signal transduction pathways of the
cell, inhibition of this GSK3β has additional undesired effects. Direct inhibition of GSK3β and Axin
binding would mimic the effect of Wnt and activate β-catenin while leaving other important biological
pathways intact. Currently, there is no assay available to directly monitor GSK3β-Axin binding, and thus
necessitating the development of such an assay.
The goal of this study is to develop a Fluorescence Resonance Energy Transfer (FRET) system by
constructing GSK3β-GFP and Axin-mCherry fluorescent fusion proteins. Plasmids were cloned to express
the fusion proteins in a mammalian or bacterial system. Eight fusion protein variants attached to
histidine tags were successfully cloned into pcDNA3.1(-). Additionally, a GFP-mCherry fusion control was
successfully cloned. Expression of the GFP-mCherry fusion protein revealed functional protein when
analyzed with confocal microscopy. Multimode plate reader analysis of the control construct confirmed
that FRET can occur between GFP and mCherry in close proximity. This is proof of concept that the
GSK3β and Axin fusion proteins will work effectively. Following identification of the ideal protein pair,
protein purified through nickel-affinity chromatography will allow for an efficient method of screening
drugs in vitro. Development of this assay will allow for identification of drugs that allow for transient
manipulation of signal transduction specific to the Wnt/β-catenin pathway.
Poster #: 91
Project Title: Spermiogenesis regulation in C. elegans: developmental genetics reveals how sperm get their groove on
Author List:
De La Cruz, Aubrie; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona, Presenting Author
Christensen, Matt; Undergraduate, Biological Sciences, California State Polytechnic University, Pomona
Clark, Jessica ; Graduate, Biological Sciences, California State Polytechnic University, Pomona
LaMunyon, Craig; Faculty, Biological Science, California State Polytechnic University, Pomona
Abstract: Spermiogenesis is the process by which spermatids differentiate to become mature spermatozoa. During spermiogenesis in C. elegans, pseudopods extend from the spermatids and enable the sperm to crawl to the fertilization site within the hermaphrodite reproductive tract. A signal transduction pathway that activates spermiogenesis involves genes in the spe-8 group (spe-8, spe-12, spe-19, spe-27, and spe-29). Mutations in any of the spe-8 group genes disrupt spermiogenesis. To identify additional genes involved in spermiogenesis, we mutagenized sterile spe-27(it132ts) worms and recovered numerous additional suppressor mutations that restore fertility to spe-27 mutants. Our laboratory has been identifying the mutated genes and their roles in spermiogenesis. The genes all seem to function in the production and regulation of a specialized sperm organelle, the fibrous body-membranous organelle (FB-MO). One gene spe-4, encodes a presenilin 1 homolog that localizes to the FB-MO membrane during spermiogenesis. spe-6 harbors a suppressor mutation, and its protein has a dual function, the first being the development of the FB-MO and the second being inhibition of spermiogenesis. Two other genes, spe-47 and Y48B6A.5, appear to associate with the FB-MO during its formation but are then degraded prior to the formation of the spermatid. The gene spe-46 has an unknown role in spermiogenesis, but the spe-46 mutation that suppresses spe-27 sterility also causes a host of other defects. Finally, a small gene, K01D12.7, also harbors a suppressor mutation. The function of K01D12.7 is unknown, but it resembles a signaling molecule. Based upon data collected, it appears that errors in the formation of the FB-MO can result in spermatids that undergo spermiogenesis spontaneously without the need for signaling through the spe-8 group. Other data suggest that SPE-6 protein interacts directly with SPE-27 protein in releasing the inhibition on spermiogenesis.
Poster #: 92
Project Title: An Investigation into the Affect of Neuronal Activity on Proper Neural Connectivity in C. elegans.
Author List:
Andersen, Kristine; Staff, Biological Sciences, San José State University
Barsi-Rhyne, Benjamin; Graduate, Biological Sciences, San José State University
Miller, Kristine; Graduate, Biological Sciences, San José State University
Vargas, Christopher; , Biological Sciences, San José State University
Pyle, Jacqueline; Staff, Biological Sciences, San José State University
Tran, Alan; Undergraduate, Biological Sciences, San José State University, Presenting Author
Duong, Alex; Undergraduate, Biological Sciences, San José State University, Presenting Author
Tsujimoto, Bryan; , Biological Sciences, San José State University
Park, Joori; Graduate, Biological Sciences, San José State University
VanHoven, Miri; Faculty, Biological Sciences, San José State University
Abstract: Neuronal activity has been implicated in the establishment and maintenance of appropriate synaptic connections in vertebrate and invertebrate systems. Activity may affect axon outgrowth, axon guidance, synaptogenesis, or the maintenance of synaptic connections. However, the mechanisms by which neuronal activity affects connectivity are poorly understood. We have utilized the synaptic partner recognition marker Neuroligin-1 GFP Reconstitution Across Synaptic Partners (NLG-1 GRASP) to label synaptic structures between PHB sensory neurons and AVA interneurons in the model organism C. elegans. In addition, we have expressed the mCherry fluorophore selectively in these cells to visualize potential defects in axon outgrowth, axon guidance, and neurite contact between pre- and postsynaptic partners in vivo. Interestingly, we find neuronal activity plays a dynamic role in both neural development and maintenance. Loss-of-function mutations in the G-alphaolf odr-3, which is required for sensory activity, result in reduced synapses between PHB and AVA neurons. Time course experiments indicate that L1s are unaffected in G-alphaolf/odr-3 mutants, suggesting that this molecule is not required for initial establishment of synapses. These results indicate that C. elegans may be a powerful model organism for elucidating the molecular mechanisms by which sensory activity mediates synaptic connectivity. Surprisingly, we also found that loss-of-function mutations in the Innexin unc-7, a gap junction component, result in reduced contact between PHB and AVA neurites, but left nerve bundles in the preanal ganglion and other regions largely intact. This indicates that electrical synapses may be required for correct contact between pre- and postsynaptic neurites within a complex nerve bundle. Our future goal is to further characterize the roles of these genes in development and maintenance of neural circuits. Funded by NIH (1R01NS087544 to MV at SJSU and NL at UCSF, 5T34GM008253 MARC undergraduate fellowship to CV, 2R25GM071381 RISE undergraduate fellowships to CV and JP), HHMI (SCRIBE 52006312 undergraduate fellowship to BB and KM), and NSF (RUMBA REU 1004350 fellowship to KA).
Poster #: 93
Project Title: The mitochondrial genomes of the nudibranch mollusks, Melibe leonina and Tritonia diomedea, and their impact on gastropod phylogeny
Author List:
Sharifi, Osman; Graduate, Biological Science, California State University, East Bay, Presenting Author
Baysdorfer, Christopher; Faculty, Biological Science, California State University, East Bay
Curr, Kenneth; Faculty, Biogical Science, California State University, East Bay
Murray, James; Faculty, Biological Science, California State University, East Bay
Abstract: The phylogenetic relationships among certain groups of gastropods have remained unresolved, especially in the diverse subclass Opishobranchia. There is a total of seventy mitochondrial genomes for gastropods published on GenBank, but the opisthobranch order Nudibranchia is not well represented. The mitochondrial genomes of the nudibranchs Melibe leonina and Tritonia diomedea have been sequenced as part of this study and both coded for the typical thirteen protein-coding genes, twenty two transfer RNAs, and two ribosomal RNAs seen in other species. M. leonina lacked a twelve-nucleotide deletion in the cytochrome oxidase 1 gene that is present in four other species of Melibe. For phylogenetic analysis, the thirteen protein-coding genes from the mitochondrial genomes of all gastropods, obtained from NCBI, were combined into a single data set. Two separate phylogenetic analyses were performed: one of the class Gastropoda and one of the subclass Opisthobranchia. Both Bayesian and maximum likelihood analyses resulted in similar tree topologies. In the Opisthobranchia, five distinct orders were distinguished as monophyletic (Anaspidea, Cephalaspidea, Notaspidea, Nudibranchia, Sacoglossa). In the Gastropoda, two of the three traditional subclasses, Opisthobranchia and Pulmonata, were seen as paraphyletic groups, whereas Prosobranchia was monophyletic. In contrast, the four more recently named gastropod clades – Vetigastropoda, Neritopsina, Caenogastropoda, and Heterobranchia – were all monophyletic, and thus appear to be better classifications for this diverse group.
Poster #: 94
Project Title: Identification of a transcriptional regulator involved in cyanobacterial cell envelope integrity
Author List:
Markary, Tanya; Undergraduate, Biology, California State University, Northridge, Presenting Author
Oliveros-Etter, Marisabel
Summers, Michael; Faculty, Biology, California State University, Northridge
Abstract: Nostoc punctiforme is a Gram-negative filamentous cyanobacteria capable of differentiating into multiple cell types including spore-like akinetes. A DNA microarray showed the two-component transcriptional response regulator Npun_F1453 was up-regulated in akinetes, indicating a potential role in their formation. Akinete expression was subsequently confirmed using a GFP transcriptional reporter strain, and the reporter in a mutant background indicated transcription was regulated by positive autoregulation. A deletion mutant exhibited preliminary death during stationary phase compared to the wild-type strain. To test for the cause of this premature death of the mutant, wild type and mutant cells were treated with lysozyme, an enzyme that degrades bacterial cell walls. The mutant cells were more sensitive than the wild type, showing increased lysis at even low concentrations. The mutant and wild type, both of which contained a GFP reporter plasmid, were also treated with EDTA to destabilize the outer membrane, and transcriptional regulation was tracked via fluorescence microscopy. Npun_F1453 transcription was up-regulated after exposure. These findings support the hypothesis that the Npun_F1453 mutant has a weakened cell envelope and is induced following envelope damage, indicating Npun_F1453 is necessary for normal envelope function. This hypothesis is also supported by DNA microarray results showing large changes in expression of genes involved in envelope structure, synthesis or deposition. The gene Npun_F1453 may therefore have important functions responsible for formation or sustainability of the multilayered cell envelope found in akinetes and for changes to the vegetative cell envelope required for Gram-negative bacterial survival in stationary phase.
Poster #: 95
Project Title: Elucidating a pathway that directs termination of sensory axon outgrowth in C. elegans.
Author List:
Thomas, Anthony; Graduate, Biological Sciences, San José State University
Zaroli, Johann; Graduate, Biological Sciences, San José State University
Jimenez, Vanessa; Undergraduate, Biological Sciences, San José State University
Wung, William; Graduate, Biological Sciences, San José State University
Vargas, Christopher; Staff, Biological Science, San José State University
Pham, Minh; Graduate, Biological Sciences, San José State University
Coto, Doris; Undergraduate, Biological Sciences, San José State University, Presenting Author
Duong, Thuy-Linh; Undergraduate, Biological Sciences, San José State University, Presenting Author
Park, Joori; , Biological Sciences, San José State University
VanHoven, Miri; Faculty, Biological Sciences, San José State University
Abstract: Critical processes such as perception, movement, and thought are achieved through communication between neurons. Dendrites receive information from the environment or other neurons and axons relay this information to other neurons via cellular junctions called synapses. Injury to axons are difficult to treat because most axons in the central nervous system extend only during development. It is thought that molecular stop signals instruct axons when to stop extending during development and may maintain this state afterwards. Identifying these stop signals and their receptors may be an important step in designing therapies for nervous system injuries. With a simple and well-characterized nervous system and conserved developmental processes, C. elegans is an ideal model organism to conduct studies on axon outgrowth termination. We have labeled PHB sensory neurons with a cytosolic mCherry fluorophore to visualize axon length in live animals. Analysis of loss-of-function mutants indicate that the transmembrane receptor SAX-3/Robo, previously isolated for its role in directing axons and cell bodies away from certain body regions, is also required for correct termination of axon outgrowth. Our goal is to investigate the role of sax-3/Robo in axon outgrowth termination and to elucidate the pathway by which it transduces the termination signal. We have determined that SAX-3/Robo functions cell autonomously in PHB neurons and is localized to the distal tip of the axon and in the cell body. Furthermore, genetic analysis indicates that the SAX-3/Robo ligand SLT-1/Slit antagonizes SAX-3/Robo in this pathway. We have also identified three cytosolic genes that are required for PHB axon outgrowth: unc-33, a homolog of CRMP-2, unc-44, a homolog of Ankyrin, and unc-76, a predicted coiled-coil protein that belongs to the FEZ family of genes. Epistasis analysis indicates that these three genes function downstream of SAX-3/Robo, suggesting a model in which SAX-3/Robo inhibits these outgrowth promoting molecules. We are currently conducting temperature shift experiments to determine if SAX-3/Robo functions in development, maintenance of axon length, or in both processes. This work is funded by the NIH (2SC3GM089595 to MV and MARC 5T34GM008253 to CV, VJ, and KB), the CSUPERB (2010 Faculty-Student Collaborative Research Seed Grant), the NSF (NSF-REU DBI-1004350 to JZ), and the HHMI (SCRIBE 52006312 to PK).
Poster #: 96
Project Title: Genetic Analysis of Histone H3 Lysine 4 Modifying Enzymes Suggests a Role for ATX4 During Leaf Senescence
Author List:
Plong, Alex; Graduate, Biological Sciences, California State University, Long Beach, Presenting Author
Brusslan, Judy; Faculty, Biological Sciences, California State University, Long Beach
Abstract: Leaves are specialized photosynthetic organs that a plant invests much of its energy and nutrients into. A leaf will undergo a period of photosynthetic productivity during growth, and then enter senescence when its photosynthetic activity diminishes. Senescence is the final stage of leaf development that results in the highly ordered degeneration of cellular organelles and reallocation of nutrients to younger developing tissue. These cellular changes are accompanied by global changes in gene expression. Epigenetic modifications, such as DNA methylation, changes in histone variants, and covalent modification of histones have been shown to influence the expression of genes. Previous ChIP-seq and RNA-seq analyses from our lab revealed a correlation between the trimethylation of histone H3 lysine 4, a mark associated with active transcription, and the expression of a subset of senescence associated genes (SAGs) during leaf senescence in Arabidopsis thaliana. Thus, the objective of this study was to investigate the role of H3K4me3 modifying enzymes during senescence to determine whether loss of function mutants exhibit any alterations in the expression of SAGs. We have isolated T-DNA insertions in five H3K4 trimethyltransferase genes, Arabidopsis trithorax (ATX), and five H3K4me3 demethylase genes, lysine demethylase 5b (KDM5b) and measured the expression of four target SAGs that change their H3K4 methylation status as leaves get older. Quantitative real-time PCR analysis from two independent biological replicates demonstrated the reduced expression of three H3K4me3-modified target SAGs in older leaves of atx4 relative to wild-type. The final H3K4me3-modified target SAG displayed a delayed down-regulation when compared to wild-type. These results suggest that atx4 may play a role in the regulation of senescence associated genes in A. thaliana leaves. A second allele of atx4 has been isolated and is currently being tested to determine if the expression patterns H3K4me3-modifed target SAGs can be replicated.
Overall, this research will lead to a better understanding of the underlying molecular mechanisms regulating leaf senescence and how epigenetics may play a role in this plant development process. This project is supported in part by The National Institute of General Medical Science Grant SC2GM092281 and a 2014 CSUPERB Faculty Student Collaborative Research Award.
Poster #: 97
Project Title: Molecular epidemiology of clinical outbreak isolates of Acinetobacter baumannii from Los Angeles County hospitals
Author List:
Kuang, Shan; Graduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Ewing, Peter; Graduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Xu, Howard; Faculty, Biological Sciences, California State University, Los Angeles
Abstract: Background. In recent decades, A. baumannii has become a problematic pathogen in hospitals world-wide. Its resistance to multiple classes of antibiotics and persistence in healthcare environments illustrate a need to understand the epidemiology of the pathogen. Previously, our laboratory examined antimicrobial susceptibility and pulsed field gel electrophoresis profiles (PFGE) of 20 A. baumannii clinical isolates from four hospital outbreaks in Los Angeles County during the late 1990s and early 2000s. Our objective was to perform molecular typing on these isolates to see the population dynamics of A. baumannii, so as to understand transmission and diversification of potential founder strains. Methods. Multilocus sequence typing (MLST) of the Pasteur Institute scheme was used to determine the sequence type (ST) of each isolate. The process involved PCR amplification of internal fragments of seven house-keeping genes, and sequencing resulting PCR products to determine allele types and ST of each isolate. Results. Two isolates from Hospital A during two outbreaks were found to be ST241 in PFGE group 3. Four isolates from Hospital B in a late 1990s outbreak were identified as ST2 and PFGE group 6. Nine isolates from Hospitals A and C in two separate late 1990s outbreaks were identified as ST10 and found in PFGE groups 1, 2 and 8. Four isolates from Hospital A during the early 2000s were found to be ST417 and in PFGE groups 4, 5 and 7. Conclusions. The high prevalence of ST10 isolates in the late 1990s, and the high prevalence of ST417 isolates in the early 2000s, indicate that they were the dominant strains to cause nosocomial infections, in which there was a transition of ST10 dominance to ST417 dominance from the late 1990s and early 2000s. Involvement of ST10 and ST417 in multiple PFGE profiles furthermore suggests possible divergent evolution has occurred for the two strains, in which they disseminated and acquired novel genes and virulence factors. In contrast, the single PFGE profiles of ST241 and ST2 isolates were present in isolated outbreak events, indicating these strains were not as evolved or disseminated as ST10 and ST417. Acknowledgements. Funding for this project was provided by a grant (W911NF-12-1-0059) from the Army Research Office and a grant (2011 Entrepreneurial Joint-Venture program) from California State University Program for Education and Research in Biotechnology.
Poster #: 98
Project Title: Regulation of plasma membrane proton pumps in response to the hormone auxin in plants
Author List:
Courtney, Lance; Undergraduate, Biological Sciences, California State University, Sacramento, Presenting Author
Wright, Deborah; Undergraduate, Biological Sciences, California State University, Sacramento, Presenting Author
Tan, Tina; Undergraduate, Biological Sciences, California State University, Sacramento
Driskill, Justin; Staff, Biological Science, California State University, Sacramento
Afshari-Nejad, Farzaneh; Graduate, Biological Sciences, California State University, Sacramento
Ewing, Nicholas; Faculty, Biological Sciences, California State University, Sacramento
Abstract: Plasma membrane proton (H+) pumps play key physiological roles in plant cells where they transport H+ out of the cell forming electrochemical gradients across the cell membrane. These gradients power secondary transporters that serve important functions including nutrient and water uptake. Extracellular H+ are also thought to drive plant growth by facilitating cellular elongation.
Auxin is one of the central hormones in plants. It plays key roles in many physiological and developmental functions including cell division, elongation, and differentiation in part by regulating gene expression. A common tool to study auxin’s effects on gene expression is the DR5 reporter construct. This construct contains several copies of a known auxin-responsive sequence fused to a reporter gene.
Previous work in our lab isolated and sequenced the tomato H+ pump gene LHA2. Analysis of the LHA2 promoter sequence revealed three copies of the auxin-responsive elements found in DR5 and we demonstrated that LHA2 was indeed auxin responsive. To test this auxin control, we prepared transgenic lines of Arabidopsis containing the LHA2 promoter in which all three of the auxin response elements were knocked out followed by a reporter gene. The current study is an analysis of the auxin responsiveness of these transgenic lines named “dude”.
Dude was germinated on growth media for two days then transferred to auxin treatments: 0, 0.1, 1, and 10 micromolar auxin-infused growth media. After four days of growth on auxin reporter gene expression was measured. The staining patterns of dude were compared to that of LHA2 and DR5. Differences in overall expression across the auxin treatments were also measured in dude via enzymatic activity assays.
The dude line showed drastic reductions in reporter gene expression overall compared to the unaltered LHA2. This was most pronounced in root meristems. In some tissues, expression was greatly reduced in sites where DR5 is not normally expressed which indicates that the DR5 elements are necessary but not sufficient alone for expression in these sites. Despite an overall reduction of reporter gene activity the mutated dude line was still responsive to auxin treatment in some tissues. This may be due to the presence of additional auxin response elements not included in the DR5 construct that may include auxin elements that have not been previously identified. This work sheds light on the fundamental mechanisms by which auxin controls plant growth.
Poster #: 99
Project Title: Investigation of Synaptic Partner Recognition in C. elegans
Author List:
Varshney, Aruna; Staff, Biological Sciences, San José State University
Benedetti, Kelli; Graduate, Biological Sciences, San José State University
Tatarakis, David; Graduate, Biological Sciences, San José State University
Watters, Katherine; Graduate, Biological Sciences, San José State University, Presenting Author
Koroglu, Yunus; Undergraduate, Biological Sciences, San José State University, Presenting Author
Shankar, Raakhee ; Staff, Biological Sciences, San José State University
Pyle, Jacqueline; Staff, Biological Sciences, San José State University
Wung, William; Graduate, Biological Sciences, San José State University
VanHoven, Miri; Faculty, Biological Sciences, San José State University
Abstract: Our nervous system is a network of neurons intricately connected into circuits, allowing information to be transferred to and processed in the brain. To form circuits, neurons must identify their correct partners among the many neurites in a target region and proceed to form junctions called synapses. Elucidating the molecular mechanisms neurons employ to identify the correct synaptic partners may help us gain a better understanding of neurological disorders in humans including autism and schizophrenia. Our research focuses on the synapses formed between the PHB-class sensory neurons and the AVA-class interneurons in the model organism Caenorhabditis elegans. Previous research in our laboratory indicated that the secreted UNC-6/Netrin ligand and its canonical transmembrane receptor UNC-40/DCC regulate synaptic partner recognition between PHB sensory neurons and AVA interneurons in C. elegans. Recently, we have discovered that the small GTPase mig-2/Rho also plays a critical role in this process. The goal of this study is to elucidate this novel role for mig-2/Rho in synaptic partner recognition. To study synaptic partner recognition, we utilize a transgenic trans-synaptic marker called Neuroligin 1-mediated GFP Reconstitution Across Synaptic Partners (NLG-1 GRASP), which fluorescently labels synapses between specific sets of neurons in live animals. Utilizing this marker, we find that mig-2/Rho mutants have a striking reduction in synapses between PHB and AVA neurons, as compared to wild type. Synapses between PHB sensory neurons and AVA interneurons are also required to sense the noxious liquid sodium dodecyl sulfate (SDS). Our laboratory has optimized a high-throughput assay to specifically test sensation of SDS, and therefore the function of the PHB-AVA circuit. Utilizing this assay, we find a deficit in SDS sensation, consistent with the reduction in synaptic structures. We are currently working to further elucidate the synaptic partner recognition pathway by isolating additional mutants with defects in synaptic partner recognition, and ordering them into a formal pathway using molecular and genetic analysis. Funded by NIH (5T34GM008253 MARC undergraduate fellowship to KB, 2R25GM071381 RISE undergraduate fellowships to JP) and NSF (1355202 to MV).
Poster #: 100
Project Title: The Far-red Reversal of the Red-light Effect on the psbA RNA Binding Protein Genes in Chlamydomonas reinhardtii Suggests a Novel Phytochrome Molecule
Author List:
Anguiano, Pedro Cesar ; Graduate, Biological Science, California State University, Fullerton, Presenting Author
Howard, Quinn; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Arce, Laura; Faculty, Biological Science, California State University, Fullerton
Cohen, Amybeth ; Faculty, Biological Science, California State University, Fullerton
Abstract: The translation of the chloroplast-encoded psbA mRNA is controlled by several nuclear-encoded proteins in the unicellular green alga Chlamydomonas reinhardtii. These RNA binding proteins (RB38, RB47, and RB60) bind to the 5’-untranslated region of the psbA mRNA. This interaction initiates the translation of the D1 protein, which is the primary electron acceptor of the photosynthetic Photosystem II complex. The expression of the rb38 and rb60 genes, as well as the psbO gene (encodes the photosynthetic Oxygen Evolving Enhancer 1 protein), is induced by red and blue light. In this study, we set out to further characterize the expression of the rb38, rb60, and psbO genes in response to several different light treatments. Dark-grown C. reinhardtii cells were exposed to single light treatments of red, blue, or far-red light, as well as various combinations of these three light qualities. Total RNA was extracted and Reverse Transcription Polymerase Chain Reaction (RT-PCR) was carried out. Gene expression was analyzed using BioRad Quantity One Software after electrophoresis of the amplified products. Our results confirmed that red and blue light induce the expression of the rb38, rb60, and psbO genes, and further revealed that the red-light induction was reversed by far-red light. While our results showed that the blue-light induction was unaffected by far-red light, blue light did accentuate the induction of these genes when combined with or followed by a red light treatment. Expression of the rb47, psbA, and actin genes remained unchanged after a shift from the dark to any light treatment. Bioinformatic analysis of the rb38, rb60, and psbO promoters revealed the presence of two putative red-light responsive cis-elements, a G-Box and GATA motif, which may play a role in the red-light induction of these genes. We have yet to identify any prospective blue light cis-elements. The far-red reversibility of the red-light induction of the rb38, rb60, and psbO genes, and the identification of red light regulatory sequences in their promoters, suggests the existence of a novel phytochrome-like photoreceptor within C. reinhardtii. Alternatively, a cryptochrome photoreceptor may play a role in the signaling pathway for the expression of these genes, perceiving blue, red, and yellow light. Future studies will focus on analyzing the effects of yellow-light exposure on the expression of the rb and psbO genes.
Poster #: 101
Project Title: The Oriental Beetle Sex Pheromone Can Arrest the Development of Pristionchus pacificus Nematode Embryos
Author List:
Renahan, Tess; Graduate, Biology, California State University, Northridge, Presenting Author
Hong, Ray; Faculty, Biology, California State University, Northridge
Abstract: Nematode parasites infect millions of people and are difficult to treat; a natural compound that arrests nematode embryos may provide new avenues for parasitic treatment and control. Understanding the necromenic interaction between nematode Pristionchus pracificus and its oriental beetle host will offer insight into nematode-invertebrate relationships that can be applied to developmental processes on a broader scale. The California P. pacificus strain suffers from permanent embryonic arrest when exposed to ZTDO during early development. This arresting capability may be a co-evolutionary response of the host in this pre-parasitic relationship; the method behind ZTDO’s ability to arrest offers an intriguing study of the nematode embryo and its susceptibility. Post in-utero, embryos take roughly 24 hours to hatch; the minimum lethal exposure time to ZTDO is four hours, and may be fewer during certain vulnerable developmental stages. It is likely that embryos are more susceptible (require shorter exposure time to ZTDO to become arrested) during the gastrulation and bean stages of embryonic development. Pre-gastrulation embryos may be protected by a protein produced during earlier stages, which will be explored through a mutagenesis. It is hypothesized that ZTDO’s mechanism is either to clog pores and prevent gas exchange or to enter the embryo and disrupt function. Microscopy has suggested that the latter is true; using the lipophilic dye FM4-64 that is known to stain membrane layers pre-anaphase oocytes in C. elegans, ZTDO-exposed embryos were stained and it was found that the dye passes the permeability barrier and stains the embryos’ plasma membranes. In ZTDO unexposed embryos, only the outermost vitelline layer of the eggshell is stained by FM4-64; the dye does not pass the permeability barrier, further supporting the notion that ZTDO is disturbing the permeability barrier and is able to interfere with cell functions, rather than prevent gas exchange. Pinpointing specific susceptible stages and ZTDO’s direct action could one day lead to potential targets for parasitic nematode treatment.
Poster #: 102
Project Title: Assessing key Mtw1 and Nsl1 domains in yeast kinetochore assembly
Author List:
Kim, Austin; Undergraduate, Biology, California State University, Monterey Bay, Presenting Author
Kudalkar, Emily; Postdoc, Biochemistry, University of Washington
Davis, Trisha; Faculty, Biochemistry, University of Washington
Abstract: Errors in chromosome segregation often lead to aneuploidy, a common characteristic of birth defects, cancer, and cell death. This has motivated scientists to study the mitotic spindle, a large molecular machine whose role is to ensure that two sister chromatids are segregated to each daughter cell. The kinetochore, a large multisubunit protein complex, is central to this process because it links the centromere of the chromosome directly to dynamic microtubule fibers. In S. cerevisiae only one kinetochore binds to a single microtubule at a time, providing a simple and conserved model for study. Our focus was to study the protein interactions that make accurate chromosome segregation possible by reconstituting purified yeast kinetochore components in vitro. One major protein interaction we investigated involved the central kinetochore component called the MIND complex and the microtubule-binding Ndc80 complex. Previous studies and crosslinking data have suggested that MIND enhances Ndc80’s binding to microtubules through specific amino acid residues. Here we utilized three recombinant forms of the MIND complex with specific mutations. These mutations were made in Mtw1 and Nsl1, two of the four subunits that constitute the complex. The first mutation involved the truncation of the C-terminus domain of Mtw1 while the second and third involved substituting four residues of an alpha helix to aspartic acids in Nsl1. We tested these mutant proteins through in vitro binding assays, which suggested that each site additively contributed to the MIND-Ndc80 interaction. In complement we conducted an in vivo plasmid shuffle experiment, which suggested that the mutations were detrimental to yeast viability in vivo. These two approaches provided insight into the structural organization of the kinetochore.
Poster #: 103
Project Title: Identification and characterization of the miRNA-155 regulatory region
Author List:
Adamian, Alina; Undergraduate, Biology, California State University, Northridge, Presenting Author
Ochoa-Bolton, Eliana; Undergraduate, Biology, California State University, Northridge, Presenting Author
Malone, Cindy; Faculty, Biology, California State University, Northridge
Abstract: We previously found miRNA-155 associated with expression in indolent Small Lymphocytic Lymphomas (SLL), but not in aggressive Mantle Cell Lymphoma (MCL), in a subtractive hybridization. These data suggest it may either contribute to the indolent nature of SLL or its absence may contribute to aggressive nature of MCL. MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression. miRNAs are a class of evolutionally conserved non-coding small RNAs of 18 to 24 nucleotides in length that participate in post-transcriptional regulation of gene expression. We hypothesize that the promoter region is found just upstream of the coding region of miRNA-155 and will control expression of this gene. We have identified, isolated and begun characteristic analysis of the putative miRNA-155 promoter region. Utilizing bioinformatic analysis, we identified an approximately 1000 bp region upstream of the 5′ UTR of miRNA-155 that we hypothesis is the miRNA-155 promoter. We also identified a TATA box and putative transcription factor binding sites, including AP-1, SP1, IRF-1, NFkB, and c-Jun within the first 300 bp of this putative promoter region. PCR primers were designed and used to PCR amplify and subsequently ligate into the CloneJet PCR cloning vector. After transformation and insert confirmation using gel electrophoresis, we confirmed our sequence by cycle sequencing. This putative miRNA155 promoter fragment was then directionally subcloned into the PGL3 luciferase reporter vector. Through deletion and site-directed mutagenesis analyses, transient transfections, and Dual Luciferase assays, we expect to identify the core promoter and transcription factors regulating the expression of miRNA-155.
Poster #: 104
Project Title: Developmental Ethanol Exposure Disrupts Lipid Metabolism and Causes Oxidative Stress in Drosophila Larvae.
Author List:
Khodabakhshi, Payam; Graduate, Biological Sciences, San José State University, Presenting Author
Luu, Peter; Graduate, Biological Sciences, San José State University
French, Rachael; Faculty, Biological Sciences, San José State University
Abstract: Fetal Alcohol Spectrum Disorder (FASD) is a collection of physiological and behavioral abnormalities caused by maternal consumption of alcohol during pregnancy. Despite decades of research, the targets of developmental ethanol exposure in mammals remain elusive. We have established a genetic model of developmental alcohol exposure (DAE) in Drosophila melanogaster that mimics the detrimental effects of FASD in mammals, allowing us to better understand the molecular mechanism of FASD. We have previously shown that DAE leads to reduced expression of Drosophila insulin-like peptides (dILPs) and their receptor (InR). Here, we report on our recent work linking this observation to dysregulation of fatty acid metabolism. Further, through genetic analysis of mutant strains defective in the response to oxidative stress as well as pharmacological manipulation of the levels of reactive oxygen species, we have shown that DAE in Drosophila causes oxidative stress and that this stress is a primary cause of the lethality and developmental delay associated with DAE. In addition, using microscopy, gene expression analysis, and genetic screening, we show that DAE causes lipid accumulation, which is one of the causes of ethanol-induced oxidative stress. These data suggest a previously uncharacterized mechanism by which ethanol causes the symptoms associated with FASD. We will present the results described above, as well as the results of our current experiments to alter developmental ethanol sensitivity through dietary changes, specifically manipulation of the level and types of fatty acids and sugars in the animals’ diets. This research was supported by a grant from the NIH National Institute of General Medical Sciences (5SC3GM103739).
Poster #: 105
Project Title: Exploring the intersection of patterning and growth control for craniofacial development in zebrafish
Author List:
Yousefelahiyeh, Mina; Graduate, California State University, Los Angeles, Presenting Author
Yu, Yang; Graduate, California State University, Los Angeles, Presenting Author
Martinez, Andrew; Undergraduate, California State University, Los Angeles
Vela, Tatiana; Undergraduate, California State University, Los Angeles
Bhandari, Ajay; Undergraduate, California State University, Los Angeles
Nissen, Robert; Faculty, California State University, Los Angeles
Abstract: The Transforming Growth Factor Beta (TGF-β) and Bone Morphogenetic Protein (BMP) signaling pathways are important for several patterning events during early embryonic development including craniofacial development. For example, BMP signaling regulates cranial neural crest cell (CNCC) induction, as well as subsequent formation of the facial primordia, tooth, lip and palate. Similarly, defects in TGF-β signaling can also cause perturbations of facial skeletogenesis. Defects in the Hippo signaling pathway that is known primarily for regulating organ size and growth control can also yield craniofacial defects such as those presented in Van Maldergem Syndrome-2. These pathways intersect because the Smads, important transcriptional mediators of TGF-β and BMP responses, utilize the transcriptional co-activator Yap/Taz that is regulated by Hippo signaling. We previously found that wdr68 is required for craniofacial development as a likely modulator of BMP responses in zebrafish. Recent work in drosophila revealed that a Wdr68-Dyrk1a complex stabilizes Yap activity. Therefore, we seek to characterize the potential roles of wdr68 in modulating TGF-β, BMP, and Hippo signaling in craniofacial development and growth control. Here, we report progress on generating three zebrafish lines. The heat shock-inducible Tg(hsp70l:dyrk1aa) line will be used to determine whether Dyrk1a overexpression can rescue craniofacial development in wdr68 knockdown (KD) embryos. Likewise, the Tg(hsp70l:Yap1-2SA) line will enable determining whether a gain-of-function Yap1 mutant can rescue craniofacial development in wdr68-KD embryos. In contrast, the Tg(hsp70l:Yap1-deltaC) line will enable determining whether a dominant-negative Yap1 mutant will exacerbate the craniofacial defects of mild wdr68-KD embryos. Here we also report progress on generating individual mouse C2C12 cell knock-out sublines for wdr68, dyrk1a, dyrk1b, yap1, or smad4 genes using lentiviral transduction and CRISPR/Cas9 technologies. These sublines will be used in transient transfection dual-luciferase (luc) reporter assays with either a SBE-luc reporter for measuring TGF-β responses or a BRE-luc reporter for measuring BMP responses. Together, these in vivo and in vitro approaches will shed light on the interplay of signaling pathways important for patterning and growth in craniofacial development. This work is supported by grants from CSUPERB and the NIH-NIDCR.
Poster #: 106
Project Title: An Escherichia coli strain capable of degrading tricarballylate, a metabolite asswociatd with grass tetany in ruminants
Author List:
Morales, Magali; Staff, Biology, California State University, Northridge
Kapucija, Stephanie; Graduate, Biology, California State University, Northridge, Presenting Author
Johnson, Tierra; St. Luke’s Medical Center
Mackelprang, Rachel; Faculty, Biology, California State University, Northridge
Bermudes, David; Faculty, Biology, California State University, Northridge
Abstract: The E. coli strain V517 contains multiple plasmids and is commonly used as a convenient source of closed circular molecular weight markers. This unusual strain is also capable of growth on citrate. We extracted total plasmid DNA and performed high-throughput shotgun sequencing. The raw sequence reads were assembled, resulting in 31 contigs totaling approximately 120 kb. One of the contig is approximately 42 kb in length and likely corresponds to a 42 kb plasmid. This contig contains the complete tricarballylate operon tcuRABC from Salmonella enterica with strongest similarity to the serotypes Typhi and Paratyphi A. The tcuRABC operon is known to confer citrate utilization due to the presence of the TcuC protein that functions as a citrate transporter. Using minimal media we were able to confirm that V517 grows using tricarballylate as a sole carbon source. We transformed a non-citrate metabolizing E. coli with a mixed preparation of the V517 plasmids and isolated transformants capable of growth on citrate that carried a single approximately 42 kb plasmid with three unique restriction enzyme sites generally consistent with the large contig sequence. The presence of these Salmonella genes in an E. coli plasmid is a clear example of horizontal gene transfer and also suggests that the E. coli strain V517 acquired the genes in an environment where the ability to metabolize tricarballylate was favorable, possibly within the gut of a ruminant. Grass tetany is an acute magnesium deficiency caused by the presence of tricarballylate, a magnesium chelating metabolite found in some animal feeds that is also produced by rumen bacteria as a product of trans-aconitate metabolism. Grass tetany is a rapidly progressing disease that results in greater than 30% mortality even when treated with dietary supplements or intravenous injections containing magnesium. Artificially introducing ruminants with probiotic bacteria capable of metabolizing tricarballylate could have the potential to mitigate grass tetany.
Poster #: 107
Project Title: YCK2 Governs Biofilm Formation by regulating UME6 expression in Candida albicans
Author List:
Zhu, Peng-Yi ; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Yeo, Lythou; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Park, Hyunsook; Faculty, Biological Sciences, California State University, Los Angeles
Abstract: Candida albicans is an opportunistic, dimorphic fungus that is a part of the mucosal microbiota. It is also a leading cause of healthcare-associated infections due to its ability to form biofilms on catheters and other plastic, indwelling devices. Morphological transition of C. albicans, a key virulence trait, is regulated by response to environmental signals and plays an important role in biofilm formation, as C. albicans biofilms have a mixture of morphological forms, from yeast to pseudohyphae to hyphae. Yet, the regulatory pathways controlling C. albicans biofilm formation is still uncertain, particularly the role of YCK2, a plasma membrane protein.
Yeast casein kinase 2 (YCK2), a member of the casein kinase 1 (CK1) family of serine/threonine kinases important for signal transduction pathways, plays a key role in governing morphogenesis in C. albicans. Gene expression studies of a yck2 deletion mutant strain showed an increased expression of UME6 in yeast and hyphal forms, but decreased expression levels of RFG1, TUP1, and NRG1 in hyphal form compared to wildtype and complemented strains. UME6 expression is known to regulate biofilm formation, while RFG1, TUP1, and NRG1, are known to be transcriptional co-repressors of hyphal genes. Furthermore, observation of yck2 mutant strain shows consititutive pseudohyphal formation in non hyphal inducing medium when compared to wildtype strain.
Thus, it is hypothesized that the high expression of UME6 in yck2 mutant strain will cause increased biofilm formation by yck2 mutant strain compared to wildtype and complemented strains, particularly in the yeast phase when normally no biofilm formation occurs. Microtiter assays tested the ability of yck2 mutant strain to form biofilm in yeast and hyphal forms under static and non-static conditions. Quantitative analysis utilized crystal violet staining, ethanol destaining, and spectrophotometry by reading the absorbance at 600 nm. Results indicate a significant increase of biofilm formation by yck2 mutant in the yeast form in both static and non-static conditions, yet there is no significant difference in biofilm formation by yck2 mutant when compared to that by wild type between the static and non-static condition of hyphal form. Further studies will follow to further understand the molecular mechanisms by which YCK2 governs biofilm formation via UME6 overexpression.
Poster #: 108
Project Title: PEAK1 kinase acts as a molecular switch to mediate TGFbeta-induced EMT in breast cancer
Author List:
Agajanian, Megan; Graduate, Biology, California State University, Northridge, Presenting Author, Eden Award Finalist
Campeau, Anaamika; Staff, Biology, California State University, Northridge
Hou, Alexander; Undergraduate, Biology, California State University, Northridge
Brambilla, Daniel; Undergraduate, Biology, California State University, Northridge
Kim, Sa La; Undergraduate, Biology, California State University, Northridge
Hoover, Malachia; Graduate, Biology, California State University, Northridge
Klemke, Richard; UC San Diego
Kelber, Jonathan; Faculty, Biology, California State University, Northridge
Abstract: Epithelial to mesenchymal transition (EMT) is essential and strictly regulated during normal development and tissue homeostasis. However, EMT is deregulated during progression of epithelial cancers to promote metastasis. TGF is a well-characterized inducer of EMT within the tumor microenvironment, but the molecular mechanisms by which TGF switches from a tumor suppressor to EMT inducer remain to be fully elucidated. We previously identified PEAK1 as a new non-receptor tyrosine kinase that associates with the cytoskeleton; binds and facilitates signaling of HER2/Src complexes; and promotes tumor growth, metastasis and therapy resistance in human cancers downstream of oncogenic Ras. PEAK1 has also been reported to promote Src-dependent focal adhesion dynamics, Grb2/Shc signaling downstream of EGFR and EMT in mammary epithelial cells. In the current study, we analyzed PEAK1 expression from published human cancer microarrays and found PEAK1 expression in breast tumor and stromal tissues correlated with poor disease prognosis. Additionally, we observed PEAK1 expression increased in HRas-transformed MCF10A or Neu-transformed HMLE cells during EMT induction via in vivo propagation (MCF10CA1h cells) or in vitro exposure to exogenous TGF (HMLE-Neu+T), respectively. To evaluate the role of PEAK1 in TGF-induced EMT, we generated empty vector (V) and PEAK1-overepxressing (P) MCF7 breast cancer cells. Overexpression of PEAK1 induced proliferation, Smad2/3 and Erk1/2 activation, and increased Src expression. Previous reports show TGF-induced EMT in breast cancer cells invokes non-canonical Src/Grb2/MAPK pathways and depends upon extracellular substrates. Therefore, we treated MCF7-V and -P cells with TGF and exposed them to various ECM proteins. While TGF did not induce EMT in MCF7 cells on plastic or in the absence of overexpressed PEAK1, TGF treatment and PEAK1 overexpression cooperatively induced EMT and migration velocity/displacement on the ECM component fibronectin. Importantly, under these same conditions PEAK1 overexpression enabled TGF to activate non-canonical Src and Erk1/2 signaling. These studies are the first to provide evidence that PEAK1 mediates signaling cross talk between TGF receptors and integrin/Src/Grb2/MAPK pathways. With this important information about PEAK1 function and mechanism, unique methods and reagents may be developed to target PEAK1 expression/function or upstream/downstream pathways to abrogate breast cancer progression.
Poster #: 109
Project Title: Cone-structors of Early Earth: Analysis of Cyanobacteria Genes Potentially Used in Microbial Cone Formation
Author List:
Tran, Kevin; Graduate, Biological Science, California State University, Fullerton, Presenting Author
Jain, Sunit; University of Michigan
Dick, Greg; University of Michigan
Johnson, Hope; Faculty, Biological Science, California State University, Fullerton
Abstract: Stromatolites are ancient layered, sedimentary structures spanning back to 3.5 billion years ago. As these structures are sometimes formed by microbial biofilms trapping sediment, they provide us with an understanding of how microorganisms interacted in early Earth. Modern microbial cones and mats, typically formed by cyanobacteria, may be precursors to these stromatolites. However, the mechanism by which these cyanobacteria form cones is not fully understood. Here, we study a cyanobacteria enrichment, composed primarily of Leptolyngbya, cultured from a microbial cone from Octopus Spring in Yellow Stone National Park. Using Ilumina sequencing and the Iterative De Brujin Graph De Novo Assembler for Short Reads Sequencing data with Highly Uneven Sequencing Depth (IDBA-UD), we identified the cyanobacteria species and three associating bacteria in the culture: Pseudomonas, Actinobacteria, and Ochrobactrum anthropi. We annotated our four genomes using Integrative Microbial Genomes and Metagenomes Expert Review (IMG/ER). The Leptolyngbya genome was analyzed for potential biofilm and phototaxis genes using the Basic Local Alignment Search Tool for Protein (BLAST-P). Many potential biofilm formation and phototaxis genes were identified; these genes may play a role in microbial cone formation. The Leptolyngbya genome was also analyzed for housekeeping genes that could be used as standards for quantitative PCR (qPCR). The housekeeping genes: ppc, rnpA, rnoA, purC, and petB, were amplified by PCR and sequenced. These will be used for qPCR analysis of the biofilm forming genes. Quantifying gene expression will help elucidate the role of biofilm formation used in cone formation by Leptolyngbya.
Thank you to CSUF state mini-grant, ASI, CSUPERB, and EPOCHS for funding.
Poster #: 110
Project Title: Defects in myosin thick filament assembly of Drosophila indirect flight muscles as a mechanism for myosin storage myopathy
Author List:
Tham, Rick; Graduate, Biology, San Diego State University, Presenting Author
Sarsoza, Floyd; Staff, Biology, San Diego State University
Trujillo, Adriana; Graduate, Biology, San Diego State University
Bernstein, Sanford; Faculty, Biology, San Diego State University
Abstract: Myosin Storage Myopathy (MSM) is a rare congenital myopathy characterized by progressive muscle weakness and reduced muscle tone. Recently, it has been linked to hypertrophic cardiomyopathy. MSM is caused by either point mutations or a single amino acid deletion in the MYH7 gene, which encodes for slow type I skeletal and β-cardiac myosin heavy chain. The histopathological hallmark of this disease is the presence of subsarcolemmal hyaline-like inclusion bodies containing aggregated myosin storage material. Myosin, a contractile protein that forms thick filaments of the sarcomere, is vital to muscle structure and function. Studies of myosin fragments in E. coli expressing human MSM mutations have reported that defects in their assembly and stability can cause MSM, however the molecular mechanism remains unclear. Furthermore, this disease has not been investigated in a more biologically relevant animal model. We are utilizing Drosophila melanogaster as a model of MSM to investigate the molecular basis of this disease. Mutations in MSM alter the electrostatic and hydrophobic properties of the myosin rod structure, and are localized around the Assembly Competence Domain; a critical region for thick filament formation. This suggests that the deleterious effects observed in MSM are due to the inability of myosin to assemble proper thick filaments or are forming them at a slower rate. Myosin proteins have the inherent ability to form thick filaments under low salt conditions. Therefore, assaying purified myosin from indirect flight muscles of Drosophila under low salt concentrations will assess filament forming ability between MSM mutants and wild-type flies. Transmission Electron Microscopy (TEM) has shown that our in vitro thick filament assembly assay is consistently forming thick filaments. The biophysical data provided from TEM will ascertain thick filament forming ability based on size. Preliminary data from pelleting assays show that a lower percentage of mutant myosin are precipitating under low salt conditions compared to wild-type. Further, Michaelis-Menten analyses seem to show that mutant myosin exhibits a lower Vmax than wildtype. The lower Vmax indicates that MSM mutant myosin are forming thick filaments at a slower rate. Altogether, successful completion of these molecular assays will help elucidate the underlying mechanism of this debilitating disease.
Poster #: 111
Project Title: Mantle Cell Lymphoma associated gene, NAP1L1, promoter isolation and characterization
Author List:
Hands, Loni; Graduate, Biology, California State University, Northridge, Presenting Author
Adamian, Alina; Undergraduate, Biology, California State University, Northridge, Presenting Author
Malone, Cindy; Faculty, Biology, California State University, Northridge
Abstract: The goal of this project is to determine the method of transcriptional regulation of the nucleosome assembly protein 1-like 1 (NAP1L1), a gene known to be produced at a higher level in mantle cell lymphoma, an aggressive cancer, versus small lymphocytic lymphoma, a less aggressive cancer in a subtractive hybridization. NAP1L1 is known to be involved in cell growth, regulation of other proteins, and chromatin assembly, making it a candidate for involvement in cancer progression. Differences in the types and quantities of proteins produced in a cell determine how the cell will behave, grow, and divide. Cancer cells are unable to control their growth and division in part because of problems in regulating protein production. Published research shows higher expression of NAP1L1 in mantle cell lymphoma versus small lymphocytic lymphoma. In order to determine the promoter elements involved in the expression of this protein, first the putative regulatory region of NAP1L1 was identified, PCR primers were designed, the PCR amplified fragment was cloned into the pGC Blue PCR cloning vector, and then directionally subcloned into the pGL3 luciferase reporter vector. After the vector was transfected into HEK293T cells, preliminary data from a Dual Luciferase Assay suggests this region functions successfully as a promoter. Bioinformatics analyses by Alibaba2.1, TFSEARCH, and Match show possible regulatory elements involved in protein expression that were used as a guide to design deletion constructs of the NAP1L1 regulatory region. Luciferase assays of these constructs will be used to measure and compare luciferase activity until a loss of luciferase function is observed, indicating that a necessary element was deleted from the regulatory region. We will continue to design new deletion constructs until the locations of specific regulatory elements within this region are determined. Identifying the mechanisms underlying production of this protein is the first step in determining why the more aggressive cancer produces more of this protein than the less aggressive cancer and could be applied to other cancers with similar regulation. Understanding more about each type of cancer may eventually lead to a treatment or cure.
Poster #: 112
Project Title: Apomine, an inhibitor of cholesterol synthesis, increases secretion of apolipoprotein E (apoE) from human astrocytoma and liver cell lines
Author List:
Ott, Christopher; Graduate, Biological Science, California State University, Fullerton, Presenting Author
Schott, Jason; Graduate, Biological Science, California State University, Fullerton
de Lijser, Peter; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Patel, Nilay; Faculty, Biological Science, California State University, Fullerton
Abstract: Apolipoprotein E (apoE) genotype is the biggest known risk factor for Alzheimer’s disease (AD). ApoE is an important protein involved with cholesterol homeostasis and other AD-associated aspects. Apomine is a potent cholesterol-reducing compound that possibly mediates its actions through proteolytic degradation of HMGCoA-reductase (the rate-limiting enzyme in cholesterol synthesis) and may affect apoE biology. We hypothesize that cells treated with Apomine are programmed to increase apoE secretion to capture and internalize more cholesterol through lipid membrane receptors from external sources to compensate for the loss of HMGCoA-reductase activity.
Treatment of both human CCF-STTG1 astrocytoma and HepG2 liver hepatocyte cells with Apomine in serum-free medium leads to a significant increase in secreted apoE (1.5-fold; determined by ELISA). Despite the increase in apoE secretion, there was not a significant increase in apoE mRNA expression (as determined by qPCR) in CCF-STTG1 cells. Consistent with our hypothesis, we found that Apomine increases expression of mRNA for surface apoE receptors. Specifically, mRNA levels for very-low density lipoprotein receptor, low-density lipoprotein receptor-related protein 1, and apoE receptor 2 were increased by 1.5 – 4 fold. Additionally, Apomine decreased mRNA levels of inducible-degrader of low-density lipoprotein receptor by half. This suggests that CCF-STTG1 cells will have increased levels of cell surface lipid receptor proteins, in preparation to uptake cholesterol-bound apoE.
In a different set of experiments, when HepG2 cells were treated with Apomine in cholesterol-containing bovine growth serum, the expected increase in apoE was completely blocked. These results indicate that the presence of cholesterol in the growth medium suppresses the cell’s drive to search for cholesterol through increased apoE secretion. These data suggest that Apomine regulates apoE expression at the post-translational level. Our current studies aim to determine kinetics of apoE mRNA production and turnover, as well as regulation of apoE translation in defined cholesterol-containing serum-free culture media. This novel regulation of apoE expression by Apomine is relevant to the fields of AD and cholesterol homeostasis.
Poster #: 113
Project Title: Cellular Mechanisms Regulating Mechanosensory Circuit Development in C. elegans
Author List:
Avina, Monika; Undergraduate, Biological Science, California State University, East Bay, Presenting Author
Tara, Boshika; Undergraduate, Biological Science, California State University, East Bay
Escalante Flores, Alejandro; Undergraduate, Biological Science, California State University, East Bay
Gallegos, Maria; Faculty, Biological Science, California State University, East Bay
Abstract: In C.elegans, response to mechanical stimuli is mediated by two mechanosensory circuits, one that functions in the anterior to promote backward movement and one that functions in the posterior to promote forward movement. The posterior neural circuit includes a mechanosensory neuron pair, PLM left and right, required for detecting gentle touch within in the posterior half of the animal. As expected for a spatially restricted function, PLM extends a sensory dendrite from the tail to just posterior to the anterior mechanosensory circuit. Interestingly, the dendrite tip of PLM forms a gap junction with the neurite tip of an interneuron, BDU. While previous work indicates that BDU is not required for mechanosensory circuit function, our preliminary data suggests that it may be required for its development.
The unc-86 transcription factor is required for specification of PLM and BDU. In the absence of unc-86, PLM and BDU are not born. Using this knowledge, we built a strain that allows the creation of two distinct mosaics: animals with PLM but not BDU and animals with BDU but not PLM. We find that in the absence of BDU, the PLM dendrite is longer in comparison to nonmosaic controls suggesting that BDU’s is required to confine the PLM dendrite to the posterior half of the animal using a contact-mediated mechanism. In our initial experiments, however, BDU was not visible. To ensure that BDU continues to make contact with PLM in the control animals of our experimental system, we re-made the strain in a way that allows us to visualize both BDU and PLM. Using this new strain, we found that BDU does maintain contact with PLM from L1 to adult in nonmosaic animals consistent with our hypothesis that BDU is required for contact-mediated repulsion of PLM dendrite growth. During the course of our analysis, we also noticed that the BDU process moves from a lateral to a ventral sublateral track in order to make contact with PLM. This observation lead to our next question, is BDU development influenced by PLM? To address this question we are now examining BDU track placement in mosaic animals that lack PLM. Currently, we are identifying rare mosaics by dissecting scope then imaging them on the confocal, to characterize and ultimately quantify the position of the BDU posterior neurite in the absence of PLM.
Poster #: 114
Project Title: The role of the central complex in visuo-motor control during obstacle avoidance
Author List:
Shinkawa, Nicole; Undergraduate, Biology, California State University, Fresno, Presenting Author
Ali, Shazia; Undergraduate, Biology, California State University, Fresno, Presenting Author
Aparicio Valenzuela, Joy; Undergraduate, Biology, California State University, Fresno
Mendoza, Sonia; Undergraduate, Biology, California State University, Fresno
Lent, David; Faculty, Biology, California State University, Fresno
Muller, Ulrike; Faculty, Biology, California State University, Fresno
Abstract: In insects, the central complex has been found to be important in the selection of motor programs and in coordinating multi-joint movement. Importantly, the central complex has been shown to, in part, represent visual information and be critical in visuo-motor integration. By understanding mechanisms of visuo-motor control mediated by the central complex we can better understand how animals interact with their environment. For functional analysis of the neural basis of the visuo-motor integration programs Drosophila melanogaster offers sophisticated methods for the genetic manipulation of a small subset of neurons. The primary focus of this study is the set of neurons that comprise the ellipsoid body, which is associated with locomotor control. The GAL4/UAS system was used to create mutant activation lines with TRPa1 channels inserted into the ellipsoid body. TRPa1 is a heat and voltage gated channel activated at ~25o C, causing neurons to fire tonically. Inactivation lines were created using GAL4/UAS expressing Kir2.1 channels, a potassium inward rectifier that hyperpolarizes neurons, along with GAL80ts, that suppresses the activity of GAL4 unless the temperature is above ~32o C. The first set of experiments involved developing multiple mutant lines to uncover the most efficient constructs. For the activation line, one GAL4/UAS cross was made and for the inactivation line, three different lines of GAL80ts crossed with the GAL4/UAS system were generated and then exposed to heat treatment. This led to the identification of the optimal constructs for the behavioral experiments. To examine the role of the central complex in the visual guidance of locomotory behavior, we have developed an arena in which we can observe and track individual wild-type and mutant flies as they perform normal vertical walking following a tap down protocol. As flies perform their vertical walking, they encounter an obstacle with high visual contrast, which requires them to maneuver around. We quantified the behaviors by investigating the distance from the barrier where the fly first initiates the turn, the time it takes to initiate to turn, and the radius at which it turns in order to explore how the central complex mediates visually guided locomotion in flies. Heat induced changes in the neural activity in the ellipsoid body neurons resulted in flies responding differently to the visual obstacle compared with control flies.
Poster #: 115
Project Title: Chemistry and Biochemistry Learning Community for First Year Students
Author List:
Works, Carmen; Faculty, Chemistry, Sonoma State University, Presenting Author
Whiles-Lillig , Jennifer ; Faculty, Chemistry, Sonoma State University, Presenting Author
Wiltse , Jared ; Faculty, Chemistry, Sonoma State University
Fukuto, Jon; Faculty, Chemistry, Sonoma State University
Abstract: In higher education, introductory science, technology, engineering, and math (STEM) courses act as gatekeeper due to their high failure and low retention rate. This discourages and prevents students from pursuing and completing degrees within STEM fields. Freshman general chemistry is a notorious gatekeeper course, and the first course many science students take in college. With growing interest and increased declaration of majors in Chemistry and Biochemistry at Sonoma State University (SSU), we have made it our mission to address attrition and success in STEM pathways. Learning communities are noted as a high impact practice, offering active, experiential, and reflective learning as well as inclusion, a sense of community, and transition elements. The SSU Chemistry Department’s model for a Freshman Learning Community (FLC) includes two year-long courses: General Quantitative Chemistry (5 units lab, discussion and lecture), and Thinking Like a Scientist (2 units), a course dedicated to critical thinking, analysis of scientific data, evaluation of claims and literature, deductive reasoning, and the scientific method. The learning community enrolls all of the chemistry and biochemistry majors that start SSU as freshman; has two lab sections, two tenured or tenure track faculty, two peer mentors, and an SI leader; and implements several high impact teaching practices such as flipped classrooms, group discussion and writing assignments, embedded technology, and student presentations. We are currently tracking the first cohort into their junior year of college, the second cohort is in organic chemistry, and starting our third cohort. Primary findings suggest that students still need maturity and motivation to work hard to pass the courses and progress through the major, regardless of the amount of resources and support available. The design and reasoning behind creating the Chemistry/Biochemistry FLC will be discussed, our assessment of the effect it has had on the first two cohorts of students will be presented along with future directions.
Poster #: 116
Project Title: Blood vessel regeneration in wound tissue seeded with collagen scaffolds containing human mesenchymal stem cells
Author List:
O’Neal, Adam; Undergraduate, Biological Sciences, California State University, Sacramento, Presenting Author
Adams, Andrew; Graduate, Biological Sciences, California State University, Sacramento, Presenting Author
Peavy, Thomas; Faculty, Biological Sciences, California State University, Sacramento
Abstract: The use of scaffolds for dermal regeneration has meant a significant breakthrough for patients suffering from burns, especially for patients with large burns. These scaffolds are generally extracellular matrices that exist in normal wound sites such as collagen or fibrin based 3D matrices. The therapeutic potential of these scaffolds is increased if they are “bio-activated” by pre-implanting cells such as human mesenchymal stem/stromal cells (hMSCs) within their matrix. One way in which hMSCs aid in wound healing is by contributing pro-angiogenic factors which is thought to stimulate blood vessel development. However, there have been few studies that have explored the best conditions for the implantation of scaffolds seeded with hMSCs for vascularization of the wound area. In the current study, we tested to see whether preconditioning the hMSCs in normal levels of oxygen (normoxia, 20% O2) as compared to low levels of oxygen (hypoxia, 3% O2) prior to seeding them into a collagen scaffold would improve their angiogenic response to vascularize the tissue within wounded mice. It is our hypothesis that culturing hMSCs in hypoxic conditions prior to treatment will lead to improved vascularization of the tissue. In our study, we examined the amount of vascularization within the implanted collagen tissue that had been seeded with cultured bone marrow derived hMSCs (normoxic versus hypoxic) within punch biopsy wounds in mice after 14 days. To this end, we examined the secretion of laminin-1 by confocal laser microscopy which is found in the basal lamina of blood vessels and has been used as a bio-marker for angiogenesis in a variety of other studies. Our studies revealed a significant increase in the amount of cell infiltration and blood vessel development within the collagen scaffold seeded with hypoxically preconditioned hMSCs. In addition, blood vessel development was primarily found at the wound edges rather than at the base of the wound bed.
Poster #: 117
Project Title: Neutralization of Listeria monocytogenes by Single Domain Antibodies
Author List:
Huh, Ian; Graduate, Chemistry, California State University, Fresno, Presenting Author
Gene, Robert; Human Health Therapeutics, National Research Council of Canada
Kumaran, Jyothi; Human Health Therapeutics, National Research Council of Canada
MacKenzie, Roger; Human Health Therapeutics, National Research Council of Canada
Brooks, Cory L.; Faculty, Chemistry, California State University, Fresno
Abstract: Listeriosis is a serious food-borne disease caused by the Gram-positive bacteria Listeria monocytogenes. The bacteria are of particular concern for pregnant women, as even in asymptomatic cases the bacteria can cross the placental barrier to cause abortion. Although the bacteria can be treated with antibiotics, inclusion of a prophylactic that can prevent Listeria colonization as a component of pre-natal care would greatly reduce the risk of Listeriosis. Bacterial invasion of epithelial cells is mediated by coupled-bindings of the virulence factors Internalin A (InlA) and Internalin B (InlB) to receptors on the target cell surface. InlA binds the E-Cadherin while InlB binds the hepatocyte growth factor receptor (c-Met) to trigger endocytosis of Listeria. Therefore, inhibition of internalin interactions with their cognate receptors may inhibit Listeria invasion. Single domain antibodies (VHH) are the smallest known antibody fragments that retain binding function. They are derived from the unique heavy chain antibodies found in camels, alpacas and llamas. Due to the convex architecture of VHH binding sites, they can access epitopes unavailable to conventional antibodies, such as enzyme active sites and protein-protein interaction sites. Using gentamicin protection assays and size exclusion chromatography we have demonstrated that InlB specific VHH are capable of inhibiting Listeria invasion of HeLa cells in vitro. Furthermore, we have discerned the molecular mechanism behind the capability of the VHH to inhibit Listeria colonization. We have obtained a high resolution X-ray crystal structure of InlB in complex with a VHH. The structure revealed that the VHH binds in a negatively charged cavity on the surface of InlB. Comparison of our structure with a structure of InlB in complex with c-Met revealed that the VHH directly competes for the same binding site as the Listeria cell surface receptor, leading to the invasion inhibition. Our results demonstrate the potential of VHH as a new class of therapeutics to protect women from Listeria during pregnancy.
Poster #: 118
Project Title: Effects of estrogen treatment on the concentration and activities of blood plasma ceruloplasmin and its copper content in rats
Author List:
Lieu, Ben; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Dalphin, Matthew; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Ha, Elisa; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Vu, Chuong; California State University Fullerton summer research student
Gonzalez, Ulises; California State University Fullerton Summer Research Student
Aguilar, Bianka; California State University Fullerton Summer Research Student
Linder, Maria C.; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Abstract: It has been clear for some time hat estrogen and progesterone-containing birth control medication increases the levels of the main copper binding protein in the blood plasma, ceruloplasmin (Cp). In earlier studies, we reported that this occurs through a combination of the stimulation of Cp biosynthesis and a decrease in its rate or removal from the blood. More recently we came back to the question about potential effects of estrogen on total plasma copper and Cp because blood samples from a patient taking prophylactics had twice the normal levels of total copper but levels of Cp protein were in the normal range, suggesting other copper components of plasma might be affected. Moreover, only about half of the Cp circulating in blood contains copper, suggesting its state of metallation might be affected by estrogen.
To begin to examine these possibilities, we treated groups of matched female Fisher rats with daily injections of 1 mg estradiol or 95% ethanol (the vehicle) subcutaneously for two weeks, and analyzed their blood plasma for total copper, Cp protein (by Western blotting), and enzyme activities associated with Cp (ferroxidase and p-phenylene diamine oxidase). Ferroxidase activity was measured in both solution and in-gel assays. To determine the ratio of holo (copper-containing) to apo- (non-copper containing) Cp, samples were subjected to native PAGE and immunoblotting, using whole plasma as well as samples that had been partially purified by anion exchange chromatography.
The results showed that estrogen treatment consistently increased levels of total copper and Cp enzyme activities (measured in solution) in the blood plasma almost 2-fold. In-gel ferroxidase activity also increased to about the same degree, as did total Cp protein measured by densitometry of immunoblots, all implying that Cp itself was responsible for the differences observed over those of the rats not treated with estrogen. Analysis of the ratio of apo to holo Cp ran into procedural difficulties that are currently being resolved and depended in part on a particularly good antibody we had trouble replacing, as well as non-specific binding of secondary antibodies.
We conclude that Cp is responsible for most or all of the increases in total plasma copper associated with use of prophylactic birth control medication that contains estrogen, but that changes in the proportion of apo to holo Cp may also be occurring.
Poster #: 119
Project Title: Interaction of the FERM Domain of Myo10 with the Tumor Suppressor p53
Author List:
Han, Stacy; Undergraduate, Biology, California State University, Fresno, Presenting Author
Gousset, Karine; Faculty, Biology, California State University, Fresno
Abstract: Myosin X (Myo10), an integrin binding MyTH4-FERM myosin, is essential in the formation of filopodia and TNTs in various cell types, and has been shown to localize in nuclear punctuates. While several labs have observed this nuclear localization, its function there has been left largely unresolved. Here we decided to explore this Myo10 nuclear function. Interestingly, Arjonen et al. have recently showed that Myo10 plays a role in mutant p53-driven cancer invasion. Moreover, another integrin binding FERM domain containing protein, FAK (Focal Adhesion Kinase) signals the nucleus during cellular stress (Golubovskaya et al. 2005; Lim et al. 2008). In fact, disruption of its integrin/ECM connection has been shown to trigger cell-cycle arrest or apoptosis by way of p53. It does this by translocating to the nucleus and enzymatically enhancing Mdm2 dependent poly-ubiquitination of p53. The connection between FAK and p53 has been shown to be dependent upon the FERM F2 lobe of FAK. We began this study by performing in silico modeling of a p53 peptide known to interact with the FERM domain of FAK, and used docking software (Dot 2.0) to predict its binding with the three-dimensional structure of the FERM domain of Myo10. Differently from similar FAK experiments, our results showed a targeted interaction with the Myo10 FERM F1 lobe, so we decided to explore this interaction further through immunoprecipitation experiments. Wild-type GFP-Myo10 was over-expressed in neuronal CAD cells and co-immunoprecipitation experiments were performed to identify possible protein binding partners. The samples were separated by SDS-PAGE. Fluorescent visualization of co-immunoprecipitated proteins using 2,2,2-trichloroethanol incorporated into the polyacrylamide gel revealed the presence of multiple bands, suggesting multiple binding partners that may form a complex with Myo10. Further analysis via western blotting has successfully identified p53 as a protein co-immunoprecipitated with GFP-Myo10 suggesting that Myo10 and p53 are part of a protein complex. Next we, will perform the opposite IP using p53 as bait and see if we can IP Myo10. p53’s involvement with the FERM F1 lobe of Myo10 may have significant implications for the study Myo10 and as well as in the field of cancer biology. Further study is necessary to fully characterize the Myo10-p53 interaction site, as well as the signaling events that regulate this interaction.
Poster #: 120
Project Title: Membrane Interaction of Peptides from the Transmembrane Segments of Wza and CsgG
Author List:
Salinas, Erika; Undergraduate, Chemistry and Biochemistry, California State University San Marcos, Presenting Author
Espino, Tanya; Undergraduate, Chemistry and Biochemistry, California State University San Marcos, Presenting Author
Jayasinghe, Sajith; Faculty, Chemistry and Biochemistry, California State University San Marcos
Abstract: Background: Wza and CsgG are channel proteins localized in the outer membrane of gram negative bacteria. These two proteins belong to a relatively new class of outer membrane proteins in which the membrane spanning region is comprised of an α-helix. In the case of the more common outer membrane β-barrels, their TM segments are inserted in to the outer membrane using a protein complex. However, the manner by which the TM segments of Wza like proteins insert into the outer membrane is not known. Here we investigated the conformation of peptides derived from the TM segment of Wza, and CsgG, and their ability to interact with artificial lipid membranes, and membrane mimetic environments, as a first step towards determining its mechanism of membrane interaction.
Methodology: Purified peptides corresponding to the transmembrane segments of Wza (WzaTM) and CsgG (CsgGTM) were purchased from LifeTein (Hillsborough, NJ). The peptides were dissolved in 1,1,1,3,3,3-Hexafluoro‐2‐propanol (HFIP) to make appropriate stock solutions. The conformation of the peptides were determined using circular dichroism (CD) spectroscopy using a Jasco J-720 spectropolarimeter. The ability of the peptides to interact with lipid membranes was investigated by measuring the wavelength maximum of Tryptophan (Trp) emission using fluorescence spectroscopy. The ability of the peptide to cause membrane disruption was investigated using a fluororophore/quencher pair loaded vesicle leakage assay.
Results: Circular dichroism spectra of WzaTM and CsgGTM in 20 mM phosphate buffer contained a minimum at 198nm indicating a primarily random coil structure. Upon the addition of lipid vesicles containing 100% POPC or 90% POPC 10% POPS we observed no change in the CD spectra indicating that neither WzaTM nor CsgGM interact with lipid vesicles. In the presence of 100 mM SDS detergent, CD spectra had minima at 208nm and 219nm showing a structural change from random coil to an alpha helix. Fluorescence spectra of the peptides in buffer contained an emission maximum at ~ 350 nm consistent with a Trp residue exposed to buffer. We observed no change in the emission maximum to lower wavelengths upon the addition of lipid vesicles indicating that the Trp residue of WzaTM, and CsgGTM, remains exposed to buffer. Our results suggest that the membrane insertion of Wza TM, and CsgGTM, may not be a spontaneous process.
Poster #: 121
Project Title: Identification and characterization of conserved proteins in the echinoderm skeleton
Author List:
Flores, Rachel; Undergraduate, Biological Sciences, California State University, Long Beach, Presenting Author
Chea, Stephenson; Undergraduate, Biological Sciences, California State University, Long Beach, Presenting Author
Satterfield, Sheri; Undergraduate, Biological Sciences, California State University, Long Beach
Quinn, Brettni; Undergraduate, Biological Sciences, California State University, Long Beach
Livingston, Brian; Faculty, Biological Sciences, California State University, Long Beach
Abstract: Specification of the cell fate of skeleton-forming cells in developing sea urchin embryos has been well characterized and the skeletal proteome of both adult and larval skeleton has been determined. Little is known, however, of the mechanism and proteins involved in the mineralization process. The components and construction of the organic matrix upon which mineral is deposited remains to be determined. A number of spicule matrix proteins have been identified in sea urchins and are present in the organic matrix during spicule formation. However, loss of function studies have indicated they may not be required for mineralization. We have taken a comparative, evolutionary approach to try and elucidate what proteins may be required for the process of mineralization. We previously characterized a partial proteome of the mineralized tissue of two brittle stars; Ophiocoma wendtii and Ophiothrix spiculata. Here we report the characterization of the skeletal proteome of the sea star Patiria miniata. By comparing the proteins present in all mineralized tissues of the sea urchin with those found in other echinoderm groups we have identified a set of conserved proteins containing similar functional domains. Surprisingly, the sea star proteome did not contain any proteins resembling the urchin or brittle star spicule matrix proteins. The sea star skeletal proteome did contain a number of proteins homologous to proteins found in sea urchin mineralized tissue. The skeletal proteomes from the two echinoderm groups also shared novel proteins with similar functional domains. We have analyzed the sequences of the proteins we identified as potentially important to determine the evolutionary relationships and to identify the sequences most highly conserved. Using the sea urchin Strongylocentrotus purpuratus as a model echinoderm, we have determined the temporal expression pattern of a number genes encoding conserved biomineralization proteins using quantitative PCR. We have also cloned fragments of these genes and generated probes to analyze the spatial expression pattern of these genes. Our comparative approach has allowed us to identify a set of conserved proteins whose role in biomineralization has not previously been examined. We have characterized the sequence relationships of these proteins among echinoderms and have begun examining their expression in sea urchin. The ultimate goal is functional characterization of these proteins role in skeleton formation.
Poster #: 122
Project Title: Effects of Bulky Aromatics on the Cytotoxicity of 1,5-Diheteroaryl-1,4-pentadien-3-ones towards Prostate and Cervical Cancer Cells
Author List:
Chen, Chengsheng; Graduate, Chemistry, California State University, Fresno, Presenting Author
Wang, Rubing; Postdoc, Chemistry, California State University, Fresno
Zhang, Xiaojie; Graduate, Biotechnology, California State University, Fresno
Chen, Qiao-Hong; Faculty, Chemistry, California State University, Fresno
Abstract: Dietary curcumin was isolated from rhizome of turmeric that has been used for long as a food additive and a traditional Indian medicine. Its potential to treat prostate cancer has been demonstrated by the in vitro cell-based experiments and in vivo studies on animal models. Curcumin represents a good example of a unique class of compounds with multiple targets and a high safety profile in human. However, its mild cytotoxic potency and poor bioavailability prompted us to search for improved curcumin-inspired anti-cancer agents for potential clinical use. In our previous studies, 1,5-Diheteroarylpenta-1,4-dien-3-ones has been identified as an optimal scaffold for the development of curcumin-based anti-cancer agents.
The present study is to explore the effect of the size of the heteroaromic rings on the cytotoxicity of 1,5-Diheteroarylpenta-1,4-dien-3-ones. Seventeen new curcumin-inspired compounds have been designed and synthesized through the Horner-Wadsworth-Emmons reaction of 1,3-bis(diethylphosphonato)acetone with appropriate aromatic aldehydes. Each of our new compound features two identical bulky, N-containing heteroaromatic rings and a dienone linker. Their structures have been determined by interpreting their 1H and 13C NMR spectra. The cytotoxicity of twelve synthesized compounds towards an aggressive cervical cell line (HeLa) and three prostate cancer cell lines (PC-3, Du145, and LNCaP) have been evaluated using trypan blue exclusion assay. All these twelve compounds exhibited better cytotoxic potency than curcumin towards above-mentioned four cancer cell lines. Three utmost promising compounds are 45-89 fold more potent than curcumin. The synthesis and cytotoxicity of this class of compounds, as well as the effect of bulky aromatics on the cytotoxicity, will be presented. This work was financially supported by California State University, Fresno (start-up funds for Q.-H. Chen), CSUPERB New Investigator Award (Q.-H. Chen), and New California Ventures, LLC 2014 mini-grant.
Poster #: 123
Project Title: Synthesis and Evaluation of 1,7-Diheteroarylhepta-1,4,6-trien-2-ones as Promising Anti-Cancer Agents
Author List:
Wang, Rubing; Postdoc, Chemistry, California State University, Fresno, Presenting Author
Keith, Joshua; Undergraduate, Chemistry, California State University, Fresno, Presenting Author
Zhang, Xiaojie; Graduate, Biotechnology, California State University, Fresno
Vue, Bao; Faculty, Chemistry, California State University, Fresno
Chen, Guanglin; Staff, Chemistry, California State University, Fresno
Chen, Qiao-Hong; Faculty, Chemistry, California State University, Fresno
Abstract: As part of our ongoing project to engineer more effective curcumin-based anti-cancer agents, 1,7-diheteroarylhepta-1,4,6-trien-2-ones were selected to explore the effect of the linker on cytotoxic potency because the hepta-1,4,6-trien-2-one linker is similar to the central linker of curcumin in shape and size. Fifteen new 1,7-diheteroarylhepta-1,4,6-trien-2-ones have been synthesized using two Wittig reactions and one aldol condensation reaction as essential synthetic steps. Their chemical structures have been established based on extensively interpreting their 1H-NMR and 13C-NMR spectra. The cytotoxicity of the synthesized curcumin-based compounds has been evaluated, using trypan blue exclusion assay, towards three prostate cancer cell lines (PC-3, DU-145, and LNCaP) and one cervical cancer cell line. All these compounds exhibit better inhibitory activity than curcumin at 10 uM and 1 uM concentrations. The design, synthesis, and cytotoxicity of this new class of 1,7-diheteroarylhepta-1,4,6-trien-2-ones will be presented. This work was financially supported by California State University, Fresno (start-up funds for Q.-H. Chen), CSUPERB 2013 New Investigator Award (Q.-H. Chen), and 2014 New California Ventures, LLC mini-grant. Joshua Keith is funded by 2014-2015 Fresno State Undergraduate Research Grant Program.
Poster #: 124
Project Title: Investigation of Biphenylcarboxylic Acid Derivatives as Sirtuin Inhibitors
Author List:
Gee, Stephanie; Undergraduate, Chemistry and Biochemistry , San Francisco State University, Presenting Author
Brown, Connor; Undergraduate, Chemistry and Biochemistry, San Francisco State University
Ma, Jingxiang; Postdoc, Chemistry and Biochemistry, San Francisco State University
Chan, Shaun; Undergraduate, Chemistry and Biochemistry, San Francisco State University
Bowler, Jeannette; Undergraduate, Chemistry and Biochemistry, San Francisco State University
Suon, Eric; Undergraduate, Chemistry and Biochemistry, San Francisco State University
Wu, Weiming; Faculty, Chemistry and Biochemistry, San Francisco State University
Amagatas, Taro; Faculty, Chemistry and Biochemistry, San Francisco State University
Abstract: Sirtuins are a group of epigenetic enzymes that regulate gene transcript. These enzymes are evolutionally conserved from bacteria to mammals. In human, this class of enzymes is known as class III histone deacetylases (HDACs: SIRT1-7). In recent years, two human sirtuin isoforms, SIRT1 and SIRT2, have attracted significant attention as potential anticancer target molecules. As part of our research program to identify SIRT1/2 inhibitor from marine-derived actinomycetes, we isolated a weak yeast sirtuin (Sir2p) inhibitor, 4-(dimethylamino)benzoic acid from a marine-derived Streptomyces actinomycete. Using this compound as a scaffold, we identified a more pronounced sirtuin inhibitor, 4-tert-butylbenzoic acid, based on a combination of medicinal chemistry approach and molecular dynamics calculations. However, this study indicated that even bulkier alkyl groups at position 4 would enhance sirtuin inhibitory activities. Based on the implication obtained from the previous study, we have newly designed a second-generation library that is composed of a series of biphenylcarboxylic acid derivatives. The detailed analysis of structure activity relationships (SARs) against the yeast sirtuin disclosed that the location of carboxylic acid and functional group to enhance sirtuin inhibitory activities. The key functional groups are carboxylic acid and halogens in position 3 and 4’, respectively. Among the tested compounds, 4’-bromo-3-biphenylcarboxylic acid showed the most potent inhibitory activities against yeast and human sirtuins. In the poster, the SAR study and sirtuin inhibitory activities will be presented.
Poster #: 125
Project Title: Chemical Synthesis of Ribonucleic Guanidine
Author List:
Van Ostrand, Robert; Undergraduate, Chemistry, California State University Channel Islands, Presenting Author
Awad, Ahmed; Faculty, Chemistry, California State University Channel Islands
Abstract: Synthetic oligonucleotides are crucial components of one type of anticancer treatment known as antisense therapy. Ribonucleic guanidine (RNG) analogs have been investigated as antisense agents that demonstrate increased binding affinity, improved cellular uptake, and enhanced resistance to nucleases. However, the synthetic protocol for RNG still requires improvement of yield and efficiency. In our current work, we explore convenient and high yield methods to synthesize RNG. Compounds are purified by flash column chromatography, and are confirmed by nuclear magnetic resonance, and high-resolution mass spectrometry. Preparation of RNG requires synthesis of 5′-,3′-, and internal monomers. We are now investigating more efficient methods for the preparation of these monomers. The synthetics scheme involves replacement of the 3′- and/or the 5′-hydroxyl groups with an amino group before the monomers are connected to produce the final oligomer with the guanidinum linkage. We have successfully synthesized the 3’-monomer with adenosine as a base and an amino group at the 5′-position of the sugar. Synthesis of the other monomers is still in progress.
Poster #: 126
Project Title: Zeolitic Imidazolate Framework Nanoparticles for Biomedical and Advanced Drug Delivery Applications
Author List:
Jones, Christopher; Graduate, Chemical Engineering, San José State University, Presenting Author
Stavila, Vitalie; Sandia National Laboratories
Ashley, Carlee; Sandia National Laboratories
Allendorf, Mark; Sandia National Laboratories
Abstract: Rapid growth in the field of nanomaterials has led to the development of many new nanoparticle (NP) based delivery methods to aid in the transporting of imaging and therapeutic agents within biological systems. Metal organic frameworks (MOFs) in particular have shown promise for use as nanoscale delivery agents in various biomedical applications. MOFs are a class of microporous crystalline materials comprised of metal ions interconnected through a network of organic bridging ligands. Zeolitic imidazolate frameworks (ZIFs), a subclass of MOFs, have demonstrated high levels of biocompatibility, as well as remarkable structural and chemical stability. ZIF-90 is of particular interest because it combines high stability and tunable particle sizes with linker aldehyde groups that enable covalent bonding of dyes and therapeutic agents. Our results show that tunable particle sizes between 20-600 nm are achievable with narrow size distributions of only 10-20 nm. These characteristics are advantageous for developing efficient nano-delivery methods since the size, shape, and chemical properties of nanoparticles often dictate their interaction and transport through cell membranes into specific biological compartments such as cancerous tumor cells.
ZIF-90 NPs were post-synthetically modified with surface functionalized fluorescent dyes for in vitro cell studies using Chinese Hamster Ovary (CHO-K1) Cells. Based on our in vitro studies, we were able to demonstrate highly efficient delivery of bio-imaging agents across cell membranes. Confocal fluorescence microscopy and flow cytometry were used to determine the amount of internalized ZIF-90 NPs, as well as particle degradation periods. NPs demonstrated a rate of internalization of over 90% into cell lysosomes remaining stable in lysosomal fluid for up to one week and for up to one month in simulated body fluid. Additionally, NPs had minimal impact on the viability of CHO-K1 cells even at exceptionally high concentrations of 1000 µg/mL, with over 80% of cells still remaining viable.
Funding provided by the Sandia Laboratory Directed Research and Development Program. Sandia is a multi-program laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy’s National Nuclear Security Administration under contract DE-AC04-94AL85000.
Poster #: 127
Project Title: Examining Aromaticity Gain in the Bergman Cyclization of Quinoxalenediynes
Author List:
Vuong, Anthony; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Tippins, Zakery; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Gherman, Benjamin; Faculty, Chemistry, California State University, Sacramento
Spence, John; Faculty, Chemistry, California State University, Sacramento
Abstract: Bergman cyclization of enediynes, which generates a reactive diradical intermediate, can be utilized to abstract hydrogen atoms from DNA leading to strand scission and cell death. A key thermodynamic driving force in the Bergman cyclization of an enediyne unit is the generation of a stable aromatic species upon quenching the diradical with a hydrogen atom donor. For the parent enediyne, (Z)-hex-3-ene-1,5-diyne, the maximum aromatic stabilization energy gain is obtained as a new benzene ring is generated from a non-aromatic starting material. For the benzannelated enediyne 1,2-diethynylbenzene, however, it is well known that the aromaticity gain is attenuated as cyclization to produce naphthalene does not generate a new aromatic ring. As a result, Bergman cyclization of 1,2-diethynylbenzene becomes reversible and the overall rate of enediyne disappearance becomes dependent on the concentration of hydrogen atom donor. We recently reported a computational study examining the effect of extended benzannelation orientation on Bergman cyclization energetics for a family of quinoxalenediyne derivatives. These calculations indicate that for extended linear benzannelation Bergman cyclization becomes increasingly endothermic as the aromaticity gain is further attenuated. Upon angular extended benzannelation, however, a new benzene sextet is created leading to reduced endothermicity and a more favorable cyclization. To examine this influence experimentally we recently completed synthetic routes to prepare the terminal 5,6-diethynylquinoxaline and 6,7-diethynylquinoxaline derivatives along with their phenyl-substituted analogs. Based on our computational data, it is predicted that the angular 5,6 diethynylquinoxalines will undergo a more favorable Bergman cyclization under thermal or photochemical conditions compared to 6,7-diethynylquinoxalines whose rate of reaction will depend on concentration of hydrogen atom donor. Our synthetic approach towards 5,6-diethynylquinoxaline and 6,7-diethynylquinoxaline derivatives, along with their respective Bergman cyclization and kinetic analyses, will be presented.
Acknowledgements: Funding for this project has been provided by CSUPERB.
Poster #: 128
Project Title: O-Alkylated Silybins: Synthesis and Anti-Proliferative Activity towards Prostate Cancer Cells
Author List:
Vue, Bao; Faculty, Chemistry, California State University, Fresno
Zhang, Sheng; Graduate, Biotechnology, California State University, Fresno, Presenting Author
Zhang, Xiaojie; Graduate, Biotechnology, California State University, Fresno
Parisis, Konstantinos; Undergraduate, Biology, California State University, Fresno
Chen, Qiao-Hong; Faculty, Chemistry, California State University, Fresno
Abstract: The current first-line and second-line treatments for castration-resistant prostate cancer can only extend the survival for months to several years. Silybin, a naturally occurring flavonolignan, has been evidenced by extensive cell-based and animal-based investigations to have therapeutic potential for prostate cancer. Silybin has been extensively used as dietary supplements, suggesting its non-toxic profile. The effectiveness of silybin as a potential anticancer clinical therapeutic is however discounted by its low potency and bioavailability. Hence, structure modifications of silybin to increase its potency and bioavailability are highly desired and are the core focus of our research project. This project was started with the exploration of its hydroxyl groups located at C-7 and C-20 as the suitable space for the chemical modifications. Twelve monoalkylated and dialkylated silybins (eleven of them are new compounds) had been synthesized and their anti-proliferative activities have been evaluated, using the WST-1 assay, towards PC-3 human androgen-independent prostate cancer cells. It has been observed that all these twelve silybin derivatives exhibited better anti-proliferative potency than silybin against the PC-3 prostate cancer cell line. Further WST-1 assay of these derivatives towards a DU-145 human androgen-independent prostate cancer cell line, an LNCaP androgen-dependent prostate cancer cell line, and a HeLa cervical cancer cell line is being conducted in our in-house bioassay laboratory. The design, synthesis, and anti-proliferative activity of these silybin derivatives will be presented. This work was financially supported by California State University, Fresno (start-up funds for Q.-H. Chen).
Poster #: 129
Project Title: Total Synthesis of the Proposed Structure of Micromide and Structural Revision of Micromide through “Split-Pool” Solid Phase Peptide Synthesis
Author List:
Wang, Lee; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Banasik, Brent; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Kanner, Arielle; Graduate, Chemistry and Biochemistry, San Diego State University
Bergdahl, Mikael; Faculty, Chemistry and Biochemistry, San Diego State University
Abstract: Filamentous cyanobacteria have provided a plethora of biologically active natural products. Some of these natural products continue to shed light on the biological mechanisms that are important to understand in the fight against cancer such as tubulin inhibition, mitochondrial-mediated apoptosis and angiogenesis. One of these natural products, Micromide, is a linear lipopeptide isolated by a group at the University of Hawaii. Micromide has been reported to exhibit an IC50 of 260 nano-M against KB cells.
We will demonstrate a highly convergent 35 step total synthesis of the reported structure of Micromide, which provided 100 mg of the final product. After careful comparison of the NMR spectra for the natural product with the synthetic material obtained suggests that the initial reported structure of Micromide is incorrect. The NMR spectrum does not match the structure of the true natural product and these NMR data differences will be presented.
In order to not only create future analogs of the Micromide compound, but also to determine the actual (or true) structure of the natural product Micromide, a quicker and shorter alternative “split-pool” solid phase synthesis of the target structure has been developed and will be presented. We hypothesize that the stereochemistry of one of the peptide residues was originally incorrectly assigned, based of comparisons from the NMR spectra. The spectroscopic assignment using NMR spectroscopy of the natural product vs. synthetic structures will be discussed and our hypothesis of the actual structure will be confirmed with experimental structural data obtained from a modified synthetic pathway. Our reported solid phase (“split-pool”) synthesis of Micromide will then allow the facile production of various analogs needed for SAR studies.
Due to the high number of N-methylated amino acids in the peptide moiety within Micromide, we employed the use of the 2-chlorotrityl resin to thereby totally inhibit the formation of diketopiperazine side products. The reported methodology also includes our own creation of an asymmetric acetate aldol reaction and a “greener” approach towards thiazoles.
Poster #: 130
Project Title: The C-H Sulfenylation of Biologically Active Aromatic Compounds; A New Way To Access Chimeric Probes for Chemical Biology
Author List:
Nalbandian, Christopher; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
St. Martin, Michael; Postdoc, Chemistry and Biochemistry, San Diego State University, Presenting Author
Gustafson, Jeffrey; Faculty, Chemistry and Biochemistry, San Diego State University
Abstract: Chimeric small molecules have long been a workhouse in chemical biology to interrogate biological systems. Seminal examples include; biotin conjugated small molecules (to determine molecular target of biologically active small molecules), antibody recruiting molecules (small molecules linked to a known antigen that selectively direct endogenous antibodies to cell), and PROteolysis TArgeting Chimeric Small (PROTACS, small molecules ligand of a protein of interest (POI) linked to known E3 ligase ligands that target proteasomal degradation selectively to your POI). Despite numerous successes, including the FDA approved drug fulvestrant, studies dealing with chimeric small molecules are often limited by difficult syntheses that require the design and implementation of new routes that allow for incorporation of a linker, often on both molecules involved in the Chimera. While pursuing studies on Lewis base catalyzed C-H functionalization we discovered that Lewis base catalysts can catalyze the sulfenylation (incorporation of S-R) of molecules that contain electron rich aromatic compounds. Through an initial catalytic optimization study that was heavily inspired by oxyanion holes in enzymes, we developed a series of novel bifunctional catalysts capable of effecting this reaction on the minute to hour timescale at room temperature. The exceptionally mild conditions of our system has allowed us incorporate functionalities (R group off of the sulfur) on to scaffolds that are ubiquitous through out chemical and biology, representing a one step synthesis of biologically active chimeric molecules from the parent molecule. We feel these studies will prove particularly useful in the field of natural product mode of action studies, where recently discovered natural product with promising activities are often complex and only available in low milligram quantities. In these cases our catalysts can allow us to quickly incorporate a moiety such as biotin, an alkyne, or a photoactivatable crosslinker through a C-S bond in one step to give molecular constructs for classical biochemical pull-down studies towards elucidating the molecular target that is responsible for the observed activity. We also feel a similar strategy can be used to assess the promiscuity of small molecule chemical probes or drug candidates, greatly expediting early stage drug discovery. As such we invite collaborators throughout the CSU life sciences to utilize this new technology.
Poster #: 131
Project Title: Highly Stereoselective Total Synthesis of Lagunamide A; Unprecedented Malarial and Anti-Cancer Bioactivities
Author List:
Kohnen, Nikki; Undergraduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Kanner, Arielle; Graduate, Chemistry and Biochemistry, San Diego State University
Banasik, Brent; Graduate, Chemistry and Biochemistry, San Diego State University
Wang, Lee; Graduate, Chemistry and Biochemistry, San Diego State University
Bergdahl, Mikael; Faculty, Chemistry and Biochemistry, San Diego State University
Abstract: Lagunamides are an interesting group of macrocyclic depsi-peptides with awesome anti-malarial, and anti-cancer properties. Recent experiments suggest the mode of action of the natural product as an intrinsic apoptotic pathway by cleavage of capsase-9, activating a downstream cascade that results in mitochondrial-mediated apoptosis, a popular target for therapeutics. With an array of biological activity and impressive IC50 values including anti-malarial properties (IC50 0.19-0.91 micro-M), significant cytotoxic properties against P388 murine leukemia cell lines (IC50 6.4-20.5 nano-M) and Ileocecal colon cancer (1.6 nano-M), Lagunamide A shows promise as an extremely powerful therapeutic agent, presenting the need for the total synthesis of the compound.
We will present a highly convergent asymmetric synthetic route to establish five of the 10 crucial stereocenters that form the absolute stereochemical backbone of the Lagunamide A target compound. Specifically; double novel VMAR (Vinylogous Mukaiyama Aldol Reaction) are employed to establish 4 contiguous stereocenters in high yield and excellent diasteromeric ratios. Moreover, a new and optimized convergent strategy introducing methodologies for coupling unique N-methylated unnatural peptide fragments, completed via solid phase synthesis to afford an advanced functionalized pentapeptide fragment will also be presented. In addition, several advanced synthetic intermediates will be presented, all of which have been fully characterized by NMR spectroscopy, X-ray crystallography, FTIR, HPLC and LCMS. We will present our tunable total synthesis of Lagunamide A, which also enables points of diversity necessary for accessing a large and diverse molecular library of anticipated extraordinary bioactivity. Analogs for structure-activity relationship (SAR) experiments and cell tests against malaria and various cancers are set as future work.
Acknowledgements:
NIH, US Army and the SDSU Foundation.
Poster #: 132
Project Title: Genistein Analogues as Anti-Cancer Agents: Synthesis, Anti-Proliferative Evaluation, and Structure-Activity Relationship Studies
Author List:
Xiong, Pahoua; Graduate, Chemistry, California State University, Fresno
De La Torre, Eduardo; Undergraduate, Chemistry, California State University, Fresno, Presenting Author
Wang, Rubing; Postdoc, Chemistry, California State University, Fresno
Zhang, Xiaojie; Graduate, Biotechnology, California State University, Fresno
Leon, Francisco; Undergraduate, Chemistry, California State University, Fresno
Chen, Qiao-Hong; Faculty, Chemistry, California State University, Fullerton
Abstract: Genistein is a bioactive isoflavone derived from soybeans. The correlation between the intake of genistein and the decreased incidence of some solid tumors (e.g. breast and prostate cancer) has been evidenced by epidemiological studies. Genistein entered clinical trial as a chemopreventive agent to prevent breast and prostate cancer in 1996. Genestein exhibits an anticancer potential in cell cultures and in animal models. However, there is only a little report on the cytotoxicity of its analogues and derivatives.
The current study is to synthesize genistein analogues for its anti-proliferative evaluation towards three prostate cancer cell lines (PC-3, DU-145, LNCaP; both androgen-dependent and androgen-independent cell lines) and one cervical cancer cell line (HeLa). Eight genistein analogues in which ring C (phenol) in genestein has been replaced by various heteroaromatic rings have been successfully synthesized through a sequence of four-step transformation with Suzuki-Miyaura coupling reaction as a key step. The structures of the synthesized analogues have been determined by extensively analyzing their 1H NMR and 13C NMR spectra. The anti-proliferative activity of the synthesized analogs against the above-mentioned four cancer cell lines have been evaluated using WST-1 based assay. We observed that they are slightly less active than genistein towards all these cancer cell lines. The design, synthesis, biological data, and structure-activity relationships will be presented in this poster. This work was financially supported by California State University, Fresno. Pahoua Xiong was supported in part by National Science Foundation (Award #: 1059994) and NIH RIMI program at Fresno State (P20 MD 002732). Eduardo De La Torre was funded by the National Science Foundation (NSF) under grant #HRD-1302873 and the Chancellor’s Office of the California State University. Eduardo De La Torre is also funded by 2014-2015 Fresno State Undergraduate Research Grant Program.
Poster #: 133
Project Title: Microbial Identification of bacteria associated with pomegranate arils
Author List:
Pruthi, Chinka; Graduate, Biology, California State University, Fresno, Presenting Author
Ford, Gretchen; Undergraduate, Biology, California State University, Fresno, Presenting Author
Mohan, Archana; Faculty, Biology, California State University, Fresno
Calderon-Urrea, Alejandro; Faculty, Biology, California State University, Fresno
Abstract: Pomegranate (Punica granatum Linn.) is a widely grown horticulture crop in many tropical and subtropical countries. There is interest in the pomegranate as a medicinal and nutritional product because of its multifunctionality and its great benefit to human health; it contains several groups of substances that are useful in disease risk reduction. Despite the benefits offered by this fruit, it still lacks worldwide acceptance. One of the reasons for this is the short lifespan of the arils (part of fruit, we consume) after separated from its outer coat. The storage temperature recommended for whole fruits varies from 0ᵒC to 10ᵒC with storage life ranging from two weeks to seven months depending on cultivar. However, when the fruit is cut open the shelf-life is limited to 1-2 weeks; this process of spoilage is known as browning. Previous studies in our lab suggest the presence of endophytic bacteria associated with the arils. Since these bacteria co-exist with the pomegranate fruit until before the fruit is open, we hypothesize that the endophytic bacteria create a micro-environment that helps prevent spoilage of intact fruit. The research presented here focus on isolation and identification of the putative bacteria associated with arils. Arils were extracted from pomegranates and some of them were treated with 10% bleach; the rest just washed with water. Then juice was extracted from arils and plated on Tryptic Soy Agar (TSA) media alone and TSA containing 20% pomegranate juice. The bacteria growing in plates containing media were sub-cultured on media supplemented with pomegranate juice and vice versa. To confirm that presence of juice affects the growth of bacteria, the colonies obtained were cultured on media having different juice concentrations ranging from 10% to 50%. The colonies when sub-cultured from media supplemented with juice plates to media-alone plates showed growth of bacteria, whereas colonies sub-cultured from media plates to media supplemented with juice plates were not able to grow, suggesting that juice allows only specific bacteria to grow. We have isolated 14 species of these bacteria although only a few are thought to be endophytic. Our results show that the pomegranate juice has controlling effects on the endophytic bacterial species. We are currently conducting Pyrosequencing on the small ribosomal RNA subunit gene, which will allow for identification of these bacterial species.
Poster #: 134
Project Title: A method to assess Reactive Oxygen Species (ROS) formation induced by Particulate Matter (PM) samples from the Central Valley in alveolar macrophages
Author List:
Waterston, Anthony; Graduate, Chemistry, California State University, Fresno, Presenting Author
Merana, Geil ; Undergraduate, Biology, California State University, Fresno, Presenting Author
Lolinco, Annabelle; Undergraduate, Chemistry, California State University, Fresno
Hasson, Alam; Faculty, Chemistry, California State University, Fresno
Dejean, Laurent; Faculty, Chemistry, California State University, Fresno
Abstract: Atmospheric particulate matter (PM) is a source of air pollution that has been linked to adverse health effects, such as chronic obstructive pulmonary disease. As an immune defense, macrophages generate high levels of intracellular reactive oxygen species (ROS), which are used by the cell to break down engulfed foreign material. In some circumstances, PM exposure has been associated with a ROS-linked oxidative stress potentially leading to peroxidation of essential cell components such as lipids and/or DNA. We work with the alveolar macrophage cell line, NR8383, to study the potential of PM samples to generate oxidative stress. Currently, we are investigating several Fresno air samples from a winter campaign, where PM was collected at different times of day. For the investigation of PM-associated ROS generation, we employ a cell-based microplate assay and flow cytometry. Dichlorofluorescein-diacetate (DCFH-DA) is a fluorophore used to measure ROS levels and serves as an indicator of oxidative stress. We use a 96-well plate format and a fluorescence microplate reader to measure the increase in ROS generation of cells treated with PM samples. In a secondary technique, we use flow cytometry for the advantage of single-cell analysis of multiple fluorophores. Along with DCFH-DA for ROS detection, we use Sytox Blue for dead cell staining as an indicator of cytotoxicity effects. Our preliminary experiments use a Fresno air sample with a high PM concentration (107 microg/mL) and a method blank to develop the two assays. Results from the microplate assay show a 138% fold change in the DCFH-DA fluorescence signal emitted by the cells after exposure to the Fresno air sample. This percentile of cells showing high ROS levels was estimated to be 146% higher than that of untreated cells if flow cytometry was used instead of the above mentioned microplate assay. These results indicate that the Fresno air sample induces PM-associated ROS generation and that this response is detectable with our microplate assay. They also show that we have developed a fast and reliable cell-based assay for the detection of PM-associated ROS generation which can be readily used for the screening of PM samples from different origins.
Poster #: 135
Project Title: Do CYP79B2 and CYP79B3 Metabolites Regulate Leaf Aging in Arabidopsis thaliana?
Author List:
Crane, Renee; Graduate, Biological Sciences, California State University, Long Beach, Presenting Author
Brusslan, Judy; Faculty, Biological Sciences, California State University, Long Beach
Abstract: During leaf senescence nutrients are mobilized towards reproductive structures to achieve maximum fertility. Premature senescence induced by hormone responses to environmental stress is known to result in low crop yield. The hormone auxin (indole acetic acid) is known to function in regulation of all developmental stages, however the role in senescence remains unclear. RNA-seq data generated by our lab has shown the up-regulation of CYP79B2 and CYP79B3 genes that function as a branch-point between the production of auxin and indole glucosinolates (IGs), small molecules known to function during defense. To investigate the role of CYP79B2/CYP79B3 metabolites in age-dependent leaf senescence in Arabidopsis thaliana we isolated single T-DNA insertion lines disrupting CYP79B2 and CYP79B3. Single mutants were crossed and two independent cyp79b2/cyp79b3 double mutants were isolated. Senescence will be tracked in these double mutants to determine if IG production plays a role in normal aging. Preliminary data suggest that IGs play a protective role, as more advanced leaf senescence was observed in double mutants. Auxin signaling was tracked during senescence using transgenic lines containing the auxin-inducible reporter gene fusions DR5::GUS and DR5:GFP. GUS staining and GFP expression were observed at the hydathodes and in the vascular tissue of young leaves. Less GUS staining was observed in older leaves, suggesting a decline in auxin signaling. DR5::GUS and DR5::GFP will be crossed into the cyp79b2/cyp79b3 double mutant to allow for further investigation of the role of auxin and IGs during senescence. Understanding the influence of hormone signaling, including auxin, during leaf senescence has important agronomical implications where a better understanding of senescence regulation would allow for manipulation of conditions in order to fully maximize crop yield.
Poster #: 136
Project Title: Influence of Nutrient Levels on Enterococcus spp.’s Growth at the Inner Cabrillo Beach, Port of Los Angeles
Author List:
Tang, Vivian ; Undergraduate, Civil Engineering and Construction Engineering Management Department, California State University, Long Beach, Presenting Author
Becerra, Michael; Undergraduate, Civil Engineering and Construction Engineering Management Department, California State University, Long Beach
Asvapathanagul, Pitiporn; Faculty, Civil Engineering and Construction Engineering Management Department, California State University, Long Beach, Presenting Author
Abstract: The physicochemical parameters, including carbon concentration (COD), ammonium ions (NH4+), nitrite ions (NO2-), nitrate ions (NO3-), total nitrogen, total phosphorus, orthophosphate, temperature and precipitation, were investigated in this study along with Enterococcus spp. abundance. The data showed the highest Enterococcus spp. abundance was found at the marsh, open beach and dock, respectively. The Pearson correlation coefficient (r) indicated significant relationships between 1) COD concentrations and Enterococcus spp. abundance at the dock, 2) Ammonia concentrations at the dock and Enterococcus spp. abundance at the beach, 3) total nitrogen concentrations at the dock and Enterococcus spp. abundance at the beach. Also, statistically significant correlation coefficient was observed between COD levels from marsh and beach locations. These findings suggest the COD, NH4+ and total nitrogen at the dock site influence the growths of Enterococcus spp. at the dock and beach sites.
Poster #: 137
Project Title: Screening of Insect Repellants, DEET and DEET-like Analogues, using Drosophila melanogaster as a model system
Author List:
Saxberg, Alexandra D. ; Undergraduate, Chemistry, California State University, Fresno, Presenting Author
Zimmerman, David; Graduate, Chemistry, California State University, Fresno
Vazquez, Salvador C.; Graduate, Chemistry, California State University, Fresno
Nguyen, Quyen; Undergraduate, Chemistry, California State University, Fresno
Maitra, Santanu; Faculty, Chemistry, California State University, Fresno
Goto, Joy J.; Faculty, Chemistry, California State University, Fresno
Abstract: Insect repellants benefit and mostly protect humans by repelling potential disease-carrying insects such as mosquitoes with West Nile virus. The active ingredient in many insect repellants include, N,N-Diethyl-meta-toluamide (DEET) which has been found to have adverse side effects. As a response to these effects, a safer active ingredient is needed. Our lab tests DEET and DEET-analogues using fruit flies as a model system for mosquitoes. The odor receptor in fruit flies (D. melanogaster) are similar to those found in the common disease carrying mosquitoes (A. gambiae). Our collaborator, synthesizes these compounds and DEET-analogues with chemical ligands that have the potential of fewer health concerns in the hopes of yielding a safer yet efficient insect repellant. For the experiments, 20 age-matched (1-5 day old) male fruit flies are tested with each analogue, and negative (no compound) and positive (DEET) controls. The experimental set-up is a petri dish with 1% agarose gel covering the bottom, ensuring that the flies have the proper amount of humidity. A pipette tip with a small piece of filter paper fitted to a microfuge tube with food in the cap is used to test each compound. The filter paper is treated with 10 µL of solution containing a test compound. After placing the flies in the petri dish we observe the number of flies in the tube or out of the tube, every hour for consecutive six hours. If a significant amount of flies (< 50%) are outside of the filter paper (i.e. do not cross the threshold of repellant to the food) we designatedthe compound as a repellant. This protocol is now opitomized and is a quick and efficient method for screening DEET-like compounds. I have determined the optimum concentraiton of 10% DEET in ethanol (90%), significantly (n=5 trials) repels a majority (average = 19/20) of the tested flies after 3-5 hours.
Poster #: 138
Project Title: Characterization of Cyanobacterial Lipid Droplets and Identification of Lipid Droplet-Associated Proteins
Author List:
Geiger, Sean Hunter; Graduate, Biology, California State University, Northridge, Presenting Author
Peramuna, Anantha; Staff, Biology, California State University, Northridge
Summers, Michael; Faculty, Biology, California State University, Northridge
Abstract: Cyanobacteria are among the most ancient and important bacteria on Earth and are evolutionarily related to chloroplasts of modern-day plants and algae. Due to the availability of genetic tools, they serve as ideal model organisms for studying photosynthesis and carbon sequestration. While cyanobacteria have been studied for years, relatively little is known about their production of lipid droplets (LDs), a novel sub-organelle of cyanobacteria. LDs have a potential role in energy storage, but their physiological role for the cell remains unknown. To understand LD formation, function, composition and potential economic use, we have characterized LD production in the cyanobacteria Nostoc punctiforme and identified genes and proteins co-localizing with LDs that may play a role in their synthesis and structure. LDs were found to be produced in N. punctiforme by staining the cells with a fluorescent lipophilic dye and observing by epifluorescence microscopy. Fructose-supplemented log phase cultures and stationary phase cultures showed increased LD production, and a strain that overproduced LDs was developed using buoyancy selection and screening. LDs were purified by density centrifugation and analyzed by thin-layer chromatography and gas chromatography-mass spectroscopy. LDs were enriched for triacylglycerol containing unsaturated C16 and C18 fatty acids, α-tocopherol, and C17 alkanes. Mass analysis of LD-associated proteins excised from a SDS-PAGE gel led to the identification of eight proteins. Two other important proteins similar to chloroplast plastoglobulins, thought to play a structural role, were identified bioinformatically. Translational reporter strains were created for each of these ten proteins in N. punctiforme, and five were found to co-localize with LDs. One co-localizing protein when overexpressed produced a 2-fold increase in the unsaturated C17 alkane heptadecane, a molecule found in biodiesel. The identification of co-localizing enzymes based on homology indicates LDs likely play important functions beyond mere lipid storage. Mutants lacking LD-associated proteins are currently being isolated and a bacterial two-hybrid system is being utilized to identify additional LD-associated proteins by testing for interactions with confirmed LD co-localizing proteins.
Poster #: 139
Project Title: Rapid Identification of Coastal Ocean Antibiotic Resistance Sentinel Species Vibrio parahaemolyticus
Author List:
Nefalar, Jason; Undergraduate; University of California, Los Angeles, Biochemistry, California State University, Office of the Chancellor
Romero, Alicia; Undergraduate, Molecular Biology, California Polytechnic State University, San Luis Obispo
Lopez, Leticia; Undergraduate, Biology, Oxnard College
Sidwell, Tiffany; Staff, University of California, Los Angeles, Pathology and Laboratory Medicine, Presenting Author
Harber, James; Faculty, Arts and Sciences, Oxnard College
Abstract: We hypothesized that a cornerstone antimicrobial resistant bacteria (ARB) species, Vibrio parahaemolyticus, could be detected rapidly and inexpensively using direct antibiotic selection, 16S amplification and inexpensive Sanger DNA sequencing. Ocean dwelling ARBs are more regularly isolated along the Southern California coast than a decade ago. Identifying the reservoirs of antibiotic resistance genes in ocean populations presents unique challenges and quantitatively monitoring ARBs as their populations expand dramatically in coastal waters during the dry summer months is desirable. As a control, a 4-day standard bacterial isolation and identification assay of ocean water isolate was performed using standard 0.2uM filtration, growth on media selective for enteric bacteria replica plating onto antibiotic media containing carbenicillin and DNA sequencing for identity. A 2-day experimental assay incorporated the direct transfer of the 0.2 uM filter to carbenicillin selective media followed by PCR and sequencing of the pooled isolates. The results of the 4-day control assay were that V. parahaemolyticus were present as one of many moderately antibiotic resistant bacteria. However, the experimental 2-day assay was able to consistently, inexpensively and reliably select for V. parahemolyticus from an identical 0.2 uM filter of ocean water. The new selection-sequencing method consistently identified a single sentinel species. In both control and experimental groups, the results of the real time fluorescence, melt curve analysis and DNA sequencing confirmed singled-species DNA amplification. We conclude that a single ARB could be used as a sentinel in surveying coastal California as an indicator of the total regional ARB population. The global increase in antibiotic resistant V. parahaemolyticus in the past ten years correlates with increases in antibiotic usage in aquaculture, agriculture and humans. Further investigation of the proximity of this species to transoceanic ports of call is suggested.
Poster #: 140
Project Title: Assessing strategic chromosomal knockouts to enhance methyl ketone synthesis in E. coli for biofuel production
Author List:
King, Sean; Graduate, Biology, San Francisco State University, Presenting Author
Chen, Joseph; Faculty, Biology, San Francisco State University
Hillson, Nathan; Lawrence Berkeley National Laboratory
Garcia Martin, Hector; Lawrence Berkeley National Laboratory
Goh, Ee-Been; Lawrence Berkeley National Laboratory
Beller, Harry; Lawrence Berkeley National Laboratory
Abstract: Microbial biofuels have received considerable attention in recent years as a potential source of renewable energy to alleviate dependence on fossil fuels. One approach to biofuel production is the synthesis of diesel-range methyl ketones (MK) in bacteria. We previously demonstrated the development of a metabolic pathway in Escherichia coli that resulted in MK production representing 40% of the maximum theoretical yield (the best reported yield to date). Recently, using the lambda Red recombinase system, we have deleted genes involved in other nonessential pathways to enhance carbon flow into the MK biosynthetic pathway, as metabolic flux analysis had identified several target genes that may further boost MK production. We are currently analyzing the resultant strains to assess the validity of our model predictions, by measuring the levels of MK and other metabolites. Further improvement of MK production would provide useful insights to the engineering of metabolic pathways for fatty acid-derived biofuel production.
This project is supported by Abengoa, the U.S. Department of Energy, and the CSUPERB Entrepreneurial Joint Venture (JV) Matching Grant program.
Poster #: 141
Project Title: Optimizing conditions for aquaculture of Danio rerio (zebrafish) larvae
Author List:
Carusetta, Nastassja; Undergraduate, California State University, Los Angeles, Presenting Author
Bhandari, Anish; Undergraduate, California State University, Los Angeles, Presenting Author
Nissen, Robert; Faculty, California State University, Los Angeles
Abstract: Danio rerio (zebrafish) is an extensively studied and highly useful model organism. The purpose of this experiment was to determine an optimal method for raising zebrafish larvae. The factors included in the determination of optimal include overall survival rate, growth rate, as well as the relative ease of the protocol. Variables considered included start date of feeding, frequency of water changes, food type, food amount, and frequency of feeding. Density of fish, water quality, and temperature were kept constant. Three types of food were used, referenced here as spirulina, golden pearl, and live brine shrimp. The starting conditions for optimization were 5 larvae raised for the first 25 days post-fertilization (dpf) in a 300 mL cup with feeding of spirulina and live brine shrimp starting at 5 dpf. Phase I of the experiment established a higher holding density and water volume, and tested for an optimal food type, food amount, water change frequency, and start date (4, 5, or 6 dpf). It was hypothesized that the group fed a combination of spirulina and live brine shrimp would yield the highest success rate but it was found during phase I of the experiment that a combination of spirulina and golden pearl (100-200 micron size) yielded a higher population success and a more uniform developmental rate. This variable also yielded larger fish, which revealed the importance of diet to zebrafish development. It was also found that starting feeding on 4 dpf yielded better results than either 5 dpf or 6 dpf, across all variables. We next hypothesized that eliminating spirulina and feeding exclusively golden pearl would further improve larvae survival by decreasing water fouling. During phase II of the experiment, we found that the difference in feeding golden pearl only versus spirulina and golden pearl was negligible when measuring survival rate. However, feeding spirulina and golden pearl resulted in slightly larger fish. We will report further optimizations that are also underway. Phase III of the experiment will further explore the effects of food quantity in proportion to number of fish. Optimizing conditions for the rearing of larval fish is not only relevant to the use of zebrafish as a model organism but also has potential relevance to aquaculture of other economically relevant species. This work is supported by grants from CSUPERB and the NIH-NIDCR.
Poster #: 142
Project Title: Assaying the Substrate Activities and Enantioselectivities of Recombinant Flavin-Dependent Monooxygenases toward Aryl Sulfides
Author List:
Jefford, Paige; Undergraduate, Chemistry, Humboldt State University, Presenting Author
Kaufman, Georgia; Undergraduate, Chemistry, Humboldt State University, Presenting Author
McGuire, Sarah; Undergraduate, Chemistry, Humboldt State University
Abstract: Flavin Monooxygenases (FMOs) and Baeyer–Villiger Monooxygenases (BVMOs) are enzymes with the potential to catalyze single-enantiomer oxidation of aryl sulfides to chiral sulfoxides. Aryl sulfoxides have a wide array of chiral-specific pharmaceutical and agricultural applications, but many of these enantiomers have yet to be selectively and efficiently synthesized (with greater than 98 enantiomeric excess). The enzymes examined in this study are FMOs from Mus musculus, Xenopus tropicalis, Homo sapiens, and BVMO4 and BVMO24 from Rhodococcus jostii RHA1. The genes were cloned into pET11a vector for expression in Escherichia coli and expression was induced in the transformed cell cultures. Whole-cell mediated transformations with various aryl sulfides were performed to determine their activity toward the substrates and to determine the enantioselectivity in catalyzing the oxidation.
Poster #: 143
Project Title: Ionic interactions are responsible for oligomerization of the C-terminal domain of human apolipoprotein A-I
Author List:
Fuentes, Lukas; Undergraduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Cong, Kan ; Graduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Weers, Paul; Faculty, Chemistry and Biochemistry, California State University, Long Beach
Abstract: Human apoA-I is an anti-atherogenic protein found in plasma. It is a single polypeptide composed of 243 amino acid residues and a molecular mass of ~28 kDa. The three dimensional structure of the protein remains unknown, however, extensive secondary structure analysis revealed that apoA-I is predominately -helical in nature. The amphipathic -helices are located primarily in the N-terminal (NT) domain, while the C-terminal (CT) domain is likely a disordered structure. Lipid-free apoA-I exists as a heterogeneous population of oligomers, ranging from monomers to pentamers. This has hampered X-ray crystallography as well as NMR to elucidate the 3D structure of the protein. The CT domain is responsible for oligomerization, and we have identified two critical lysine residues that are likely responsible for oligomerization. These residues, K238 and K239, were mutated into glutamine, and the extent of oligomerization was substantially reduced as judged from chemical crosslinking with dimethylsuberimidate and Gdn-HCl denaturation analysis. Thus, it seems plausible that these lysines form ionic bonds with oppositely charged residues in neighboring apoA-I. Amino acid sequence analysis showed that E234 and E235 are in close proximity to these lysines. Thus when the CT domains of apoA-I associate and align side-by-side, intermolecular ionic bonds with K238 and K239 may form. To test this, E234 and E235 were changed to glutamine by site-directed mutagenesis. The E/Q mutant proteins were over-expressed in E. coli, and purified with Ni-affinity chromatography. Circular dichroism showed that the mutant proteins retained their secondary structure. However, the amount of cross-linking was reduced substantially. This result indicates that both lysine and glutamate residues in the CT domain are responsible for oligomerization. The K and E mutant apoA-I will be excellent candidates to produce protein crystals to solve the high resolution structure of the protein.
Poster #: 144
Project Title: Double-strand Break Repair between DNA repeats separated by 10,000 base pairs is carried out by Single-strand Annealing
Author List:
Tran, Samuel; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Fischhaber, Paula; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Single Strand Annealing (SSA) and Synthesis Dependent Strand Annealing (SDSA) are two pathways which repair DNA Double-strand Breaks (DSBs). It is important to understand which pathway cells use because repair by SDSA preserves DNA sequence but SSA always changes it.
This project uses the yeast, Saccharomyces cerevisiae, as a model system because DSB repair in yeast is very similar to that in humans. Our goal is to investigate whether Rad10 protein, which is required for both SSA and SDSA, can be recruited to DSBs flanked by distally-situated DNA repeats. To this end, we cloned a panel of strains of S. cerevisiae containing an inducible DSB site (an I-SceI restriction enzyme site) flanked by DNA repeats 10 kilobase pairs apart in which the inducible DSB site is fluorescently labeled (DSB-RFP). The strains contain a fluorescently labeled RAD10 gene (Rad10-YFP) to monitor recruitment of Rad10 to DSB repair sites via formation of Rad10-YFP/DSB-RFP colocalized foci and, therefore, the progression of SSA and SDSA. The panel members differ in genetic status of RAD51, which is only required for SDSA, or RAD52 which is required for both SSA and SDSA. The three strains are either wild-type in both genes, deleted of RAD51 (rad51∆) or deleted of RAD52 (rad52∆). In this assay, expression of the I-SceI enzyme (and therefore DSBs) is induced from a plasmid in situ, by addition of galactose to the yeast culture.
Fluorescence microscopy experiments with these strains show that following induction of DSBs 62% of rad51∆ cells contain Rad10-YFP/DSB-RFP colocalized foci, while only 31% of uninduced controls contain colocalized foci, representing a 2.0-fold induction. Similarly, 52% of wild-type induced cells contain colocalized foci while only 21% of uninduced controls contain colocalized foci, a 2.5-fold induction. The rad52∆ negative control cells contain 16% colocolized foci in both induced and uninduced samples and therefore no induction. Importantly, induction of colocalized foci is observed in G1 phase cells, which cannot repair by SDSA due to the lack of a templating sister chromatid. Together, these data indicate that Rad10-YFP is being recruited to I-SceI-induced DSBs in a RAD51-independent fashion and therefore repair of DSBs located between distal DNA repeats proceeds by SSA.
The authors gratefully acknowledge funding from the NIH (grant SC3GM093858).
Poster #: 145
Project Title: Ubiquitylation of Proteasome Shuttle Proteins during Nucleotide Excision Repair in Saccharomyces Cerevisiae
Author List:
Odango, Jane; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Benoun, Joseph; Graduate, Chemistry and Biochemistry, California State University, Northridge
Fischhaber, Paula; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Nucleotide Excision Repair (NER) is a repair pathway that corrects DNA damage involving a single strand of DNA. Ultraviolet radiation (UV) exposure can induce cyclobutane pyrimidine dimers and 6,4-UV photoproducts in DNA, damage that is reparable strictly by NER. These lesions stall replication, which can lead to mutations that cause cancer. NER communicates with several other biologic pathways including the proteasome. Dsk2 is a shuttle that transports ubiquitylated “cargo” proteins to the proteasome for degradation. In NER, the Rad7 ubiquitin ligase complex has been shown to ubiquitylate the DNA damage recognition factor, Rad4, but it isn’t known whether Rad7 ubiquitylates other proteins. In a prior investigation, we obtained evidence that Rad7 may influence the ubiquitylation of several proteasome shuttle proteins including Dsk2 following DNA damage by benzo[a]pyrenediolepoxide (BPDE). We wanted to determine whether similar results would be obtained following DNA damage by another agent that also gives rise to damage repaired only by NER.
This project focuses on determining whether there is increased ubiquitylation of Dsk2 following UV damage and, if so, whether Rad7 regulates it. Experiments were carried out by exposing the yeast, Saccharomyces cerevisiae, to UV and analyzing protein extracts. Gel electrophoresis and immunoblots were carried out to separate and identify the proteins. Immunoblots were analyzed by comparing the levels of high molecular weight Dsk2 species observed to levels observed in unirradiated controls. Our data show high molecular-weight species in the UV-treated samples that are not present in unirradiated controls, which indicates post-translational modification of Dsk2 and may represent polyubiquitylated Dsk2. Together with our earlier data, these results indicate that Dsk2 may become ubiquitylated following DNA damage by both BPDE and UV. Efforts are underway to prove the high molecular weight species observed represent ubiquitylated proteins.
We are grateful for funding from the NIH (SC3GM093858) and Research Corporation (CC7146/7267).
Poster #: 146
Project Title: Characterization of a polyphenol oxidase enzyme from the thermophilic bacterium Thermomicrobium roseum
Author List:
Baginski, Robin; Graduate, Chemistry and Biochemistry, California State University, East Bay, Presenting Author
Sommerhalter, Monika; Faculty, Chemistry and Biochemistry, California State University, East Bay
Abstract: The enzyme polyphenol oxidase (PPO) can be used in various biotechnological applications including bioremediation of phenolic contaminants for industrial waste water treatment, crosslinking of proteins in the food industry, and biosynthesis of the Parkinson’s drug L-DOPA. PPO can be found in plants, animals and bacteria. PPO enzymes from thermophilic bacteria could be of unique use for high temperature applications. Kwang-Hoon Kong and coworkers reported PPO activity for an enzyme isolated from Thermomicrobium roseum (Biotechnol. Appl. Biochem. (2000) 31:113-118). Their reported N-terminal sequence, however, did not match with any sequence in the recently published genome of T. roseum and instead matched with 13 out of 14 reported amino acids to the N-terminal sequence of an alkaline phosphatase from the organism Pseudomonas aeruginosa. The aim of our study is to characterize PPO activity in T. roseum extracts and to obtain sequence information using proteomic analysis of the purified enzyme so that the actual gene can be identified. After gene identification, the sequence can be cloned and over-expressed recombinantly in E. coli for industrial bulk production of a thermostable PPO enzyme.
T. roseum cultures were obtained from the American Type Culture Collection. T. roseum was grown in ATCC culture media at 70°C. Cells were lyzed by sonication. An enzyme activity assay for PPO detection in crude cellular extracts was developed using catechol as substrate. The optimal pH was found to be pH 7.5 which exhibited adequate activity without the unwanted effects of substrate auto-oxidation. As typical for PPO enzymes, the surfactant sodium dodecyl sulfate was found to be an activator while sodium chloride was found to be an inhibitor. Protein electrophoresis with activity staining was used to estimate the enzyme’s molecular weight ( ~106 kDa) and to confirm that only one protein in the crude extract was contributing to the observed catecholase activity. Classical methods, such as ammonium sulfate precipitation, resulted in a purification fold of 4.8 at a yield of 34%. Ion exchange chromatography yielded a slightly higher purification fold of 6.6 at a similar yield of 30%. Affinity column chromatography with a specific PPO bait is currently being pursued.
This project was funded by Bio-Rad Laboratories. MS received a faculty support grant from CSUEB.
Poster #: 147
Project Title: Characterization of the C-terminal domain of human apolipoprotein A-I via a novel apolipoprotein chimera
Author List:
Horn, James; Undergraduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author, Nagel Award Finalist
Ellena, Rachel; Graduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Tran, Jesse; Undergraduate, Chemistry and Biochemistry, California State University, Long Beach
Narayanaswami, Vasanthy; Faculty, Chemistry and Biochemistry, California State University, Long Beach
Weers, Paul; Faculty, Chemistry and Biochemistry, California State University, Long Beach
Abstract: Human apolipoprotein A-I (apoA-I) is a 28 kDa exchangeable apolipoprotein and is the major protein component of high-density lipoproteins, playing a critical role in reverse cholesterol transport. ApoA-I has a two-domain structure: an α-helical N-terminal domain (NT, residues 1-189) and a less structured C-terminal domain (CT, residues 190-243). To examine the properties of the CT domain of apoA-I independent from the NT domain, a novel chimeric apolipoprotein was engineered by attaching residues 179 to 243 of apoA-I to apolipophorin III (apoLp-III). This insect apolipoprotein is used as a model and has a one domain structure made of a bundle of α-helices. The apoLp-III/apoA-I chimera was expressed in E. coli BL21 DE3 cells and purified using nickel affinity chromatography. Western blot analysis confirmed the presence of apoA-I within the chimera. ApoLp-III is monomeric but cross-linking studies with dimethyl suberimidate showed that the chimera self-associates similar to apoA-I. Far UV circular dichroism showed that the chimera displayed less α-helical content compared to apoLp-III which is consistent with the addition of an unstructured domain. Denaturation analysis using guanidine HCl showed that the protein stability of the chimera was increased compared to apoLp-III. Functional analysis showed that the chimera was able to solubilize phospholipid vesicles at a much faster rate compared to apoLp-III. Since the addition of the CT domain of apoA-I to apoLp-III resulted in oligomerization and enhanced lipid binding, these properties reside in the CT domain of apoA-I and could be transferred to apoLp-III. This demonstrates the potential to use the chimera as a tool to study the CT domain of apoA-I. This project was supported by the National Institutes of Health SC3GM089564.
Poster #: 148
Project Title: Survey of Polyphenol Oxidase Enzymes in the Brassicaceae Plant Family
Author List:
Kaur, Karishma; Graduate, Chemistry and Biochemistry, California State University, East Bay, Presenting Author
Sommerhalter, Monika; Faculty, Chemistry and Biochemistry, California State University, East Bay
Abstract: Polyphenol oxidase (PPO) is a very ubiquitous copper containing enzyme found in plants, animals, and some bacteria. PPO controls the production of pigments, such as melanin, in the skin and hair of animals. It also initiates the browning reaction of cut or bruised vegetables and fruits. As the plant tissue is wounded, PPO catalyzes the oxidation of phenols into quinones and the quinones polymerize to form pigments. Some plants, such as poplar or potato, are known to contain several PPO genes with tissue dependent expression patterns. The plant model organism Arabidopsis thaliana (watercress) is a notable exception as its genome does not show evidence for any PPO gene. A. thaliana belongs to the Brassicaceae family which encompasses mustard plants, crucifers, and cabbages. In this research project we aim to elucidate whether other Brassicaceae family members do or do not house PPO enzymes. This might enable us to trace the loss of the PPO gene(s) in A. thaliana and potentially other Brassicaceae family members.
We currently approach this question with a biochemical method. First, a crude plant extract is prepared from leaves or other parts of a Brassicaceae plant. These extracts are loaded onto polyacrylamide gels for electrophoretic separation (PAGE). In contrast to most other enzymes, PPOs are activated by the anionic detergent sodium dodecyl sulfate (SDS). We exploit this property to achieve better sample resolution via SDS-PAGE. Finally, the gels are stained for PPO activity using phenolic model substrates (catechol or 4-methyl-catechol) and 4-amino-N,N-diethylaniline sulphate (ADA) for enhanced color development via conjugation of the formed quinone and ADA.
As expected, we were able to detect electrophoretic bands for several PPO isoforms in potato and poplar leaves. We corroborated that A. thaliana has no biochemical PPO activity, in contrast to cabbage and arugula which also belong to the Brassicaceae family. We introduced PPO inhibitors and copper chelators into the gel staining procedure and confirmed that the stained electrophoretic bands are indeed coming from typical PPO enzymes.
In the future we are planning to extent this study with more Brassicaceae family members and to complement the biochemical approach with biomolecular DNA sequencing techniques.
Funding for this project was obtained via a Faculty Support Grant from CSU East Bay.
Poster #: 149
Project Title: Requirement of Saw1 in recruiting an endonuclease to double-strand breaks during single-strand annealing repair in Saccharomyces cerevisiae
Author List:
Nalbandyan, Linette; Graduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Miller, Aaron; Graduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Mrdroosian, Melina; Undergraduate, Chemistry and Biochemistry, California State University, Northridge
Fischhaber, Paula; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Clastogens can cause double-strand breaks (DSBs) in DNA giving rise to chromosomal alterations that can lead to cancer in humans. DSB repair can occur by homologous recombination (HR), a process divided into genetically distinct subpathways, one of which is single-strand annealing (SSA). In the yeast, S. cerevisiae, the SSA pathway requires 3′ flap cleavage by the Rad1-Rad10 endonuclease, which may be recruited to SSA sites by Saw1.
To investigate the requirement of the SAW1 gene in recruiting Rad1-Rad10 to 3′ DNA flaps, we prepared yeast strains either expressing wild-type SAW1 (WT) or deleted of SAW1 (saw1Δ). Strains contain an inducible DNA double-strand break (I-SceI) site flanked by DNA repeats lying either 20 or 1000 base pairs apart, giving rise to 3′ flaps of ~10 (short flap) or ~500 (long flap) nucleotides in length during repair. All strains also have fluorescently labeled RAD10 (Rad10-YFP) and a fluorescent label near the DSB site (DSB-RFP). Strains were transformed with a plasmid bearing the I-SceI gene under the control of the GAL1 promoter, enabling induction of DSBs in situ by addition of galactose to yeast cell cultures. Induced and uninduced cultures were analyzed by two different methods. First, fluorescence microscopy was performed and images analyzed for the presence of bright punctate regions of fluorescence containing both Rad10-YFP and DSB-RFP (colocalized foci), indicating Rad10 recruitment for repair. Second, genomic DNA extracts were used to template real-time PCR (qPCR) to monitor the depletion of unrepaired DNA substrate levels.
Microscopy data show that in G1 phase cells in strains containing long flap substrates, Rad10-YFP/DSB-RFP colocalized foci are not induced in saw1Δ cells whereas 4.0-fold induction is observed in WT. Results of qPCR experiments with long flap strains show delayed loss of unrepaired substrate in saw1Δ cells relative to WT. In contrast, microscopy results with short flap strains show proficient recruitment of Rad10 in G1 phase in both saw1Δ and WT cells (1.6 and 1.4-fold induction, respectively). Results of qPCR experiments with short flap strains show minimal difference in the extent of repair between saw1Δ and WT cells. Thus, our data support the conclusion that DNA repair by SSA requires SAW1 when repair sites contain long 3′ flaps, but that SAW1 is dispensable for SSA repair of DSBs containing short flaps.
The authors gratefully acknowledge funding from the NIH (grant SC3GM093858).
Poster #: 150
Project Title: Identification of Yeast Env7 Phosphorylated Residues
Author List:
Garfinkle, Elizabeth; Undergraduate, Biological Sciences, California State University, Long Beach, Presenting Author Q50
Gharakhanian, Editte; Faculty, Biological Sciences, California State University, Long Beach
Abstract: The baker’s yeast, Saccharomyces cerevisiae, vacuole is functionally analogous to the human lysosome. A novel genomic screen was performed in our laboratory to identify genes involved in the last stage of trafficking to the lysosome. ENV7 is one of four novel genes identified, and its product is involved in defects at the late endosome and vacuole interface. We have shown that Env7 is a phosphorylated palmitoylated protein kinase that is also conserved in humans. Based on bioinformatic studies in our lab on Env7, we hypothesize that Env7 phosphorylation is occurring at the specific C-terminus serine residues 236, 287, 300, and 331. The objective is to isolate the phosphorylated C-terminus fragment and identify its phosphorylated residues. A protease inhibitor assay was performed to maximize partially degraded C-terminal fragments of Env7-HA without excess protein degradation. The developed protocol was used to generate fragments of wild type Env7 and mutant Env7 Cys13-15Ser, which does not autophosphorylate in vitro. The partially degraded protein samples were separated using SDS-polyacrylamide gel electrophoresis and visualized using a Western blot. The phosphorylated C-terminal fragments traveled a shorter distance relative to non-phosphorylated Env7 due to their heavy weight. Wild type fragments showed a doublet band, whereas the corresponding fragment for Cys13-15Ser showed a strong, lower single band. This shows that the strong, top band of the doublet present in wild type may be the phosphorylated residue of interest. It also proves that the Cys13-15 track is necessary for kinase activity of Env7. More protocols will be developed and performed on other Env7 mutants, and visualized with other gel electrophoresis procedures to compare the phosphorylated fragments. Identification of the phosphorylated residues will be performed with mass spectroscopy of the isolated fragments.
Poster #: 151
Project Title: Uncovering Small Molecule Inhibitors for The West Nile Virus NS2B-NS3 Protease
Author List:
Truong, Julianne; Undergraduate, Chemistry & Biochemistry, California State University, Fullerton, Presenting Author
Nguyen, Catherine; Undergraduate, Chemistry & Biochemistry, California State University, Fullerton, Presenting Author
Salzameda, Nicholas; Faculty, Chemistry & Biochemistry, California State University, Fullerton
Abstract: The West Nile virus (WNV), a flavivirus, has rapidly spread throughout the United States and has been a global epidemic since the early 1990’s. The virus is spread to humans via infected mosquitoes taking human blood meals. Severe WNV infections attack the central nervous system resulting in meningitis which can be fatal. Currently there are no approved therapeutic treatments for WNV infections, only the symptoms can be managed. A therapeutic target for WNV infections is the viral NS2B-NS3 protease, which is responsible for viral replication and assembly in infected host cells. Inhibition of the NS2B-NS3 protease has been reported to halt viral replication in cells, thereby ending the infection. The goal of this project is to identify small molecule inhibitors for the NS2B-NS3 protease. With the ultimate goal of developing a viable therapeutic treatment for WNV infection.
To accomplish our goal, we utilized a novel substrate activity screen (SAS) approach to identify NS2B-NS3 protease inhibitors. 144 structurally diverse carboxylic acids were coupled to a reporter molecule, 7-N-(fluorenylmethoxycarbonyl) aminocoumarin-4-acetic acid, via an amide bond. The synthesized library was incubated with the NS2B-NS3 protease, and monitored for cleavage of the amide bond releasing the reporter group. Compounds that are cleaved by the NS2B-NS3 protease are considered NS2B-NS3 protease binders. Confirmed small molecule binders are converted to inhibitors by removing the cleavable reporter group and replacing with a pharmacophore. Thus creating a non-cleavable molecule, that binds in the WNV NS2B-NS3 active site. A high through FRET based inhibitor assay will be utilized to screen the novel inhibitors created via the SAS screen.
The SAS has identified two small WNV NS2B-NS3 protease small molecules binders. The newly discovered small molecule are being optimized to improve binding and will be converted into potent inhibitors for the NS2B-NS3 protease. After converting the compounds into inhibitors, they will be tested against the NS2B-NS3 protease and monitored for true inhibition.
Poster #: 152
Project Title: Recombinant Protein Expression of an Inactive AaET Protease from the Virus Vector Aedes Aegypti Mosquito
Author List:
Gallimore, Jamie; Undergraduate, Chemistry, San José State University, Presenting Author
Rascon, Alberto; Faculty, Chemistry, San José State University
Abstract: Yellow fever, dengue fever, and chikungunya viruses are spread from the Aedes aegypti mosquito to a human host upon bloodmeal acquisition. The mosquitoes, and consequently the viruses, are found in subtropical areas like South America and Africa. However, due to increase climate temperatures, the mosquitoes are flourishing in regions of the United States that were unable to sustain their lifecycle. Additionally, cases of both dengue and chikungunya infections have been reported across the United States. Although a vaccine exists to combat the yellow fever virus, no vaccines are available against the dengue fever and chikungunya viruses. Only female Aedes aegypti mosquitoes take in a bloodmeal. The proteins in the bloodmeal are digested producing nutrients for egg formation. This digestive process is facilitated by the release of specific midgut proteases. Our goal is to study individual midgut proteases involved in bloodmeal digestion and develop mosquito specific inhibitors against this process. By inhibiting bloodmeal digestion the fecundity of the mosquito would be reduced resulting in a decrease in virus transmission. The AaET protease has been found to be one of the main proteases involved in bloodmeal digestion. AaET is a serine protease with a trypsin domain containing the typical His-Ser-Asp catalytic triad. Previous studies conducted by our lab, cloned the AaET gene into a bacterial pET28a expression vector yielding a his6-tagged protease. We found AaET to be autocatalytic, activating itself and losing the his6-tagged needed for purification. To keep the protease from auto-activating and to facilitate purification, the propeptide amino acid at the cleavage site was mutated from an arginine to an alanine. Surprisingly, protein expression experiments yielded two protein species on the SDS-PAGE gel compared to wild type. We hypothesize that the two species are the full-length inactive zymogen form with the his6-tag and the inactive zymogen without the his6-tag. This was confirmed by using a stain that specifically binds to his6-tagged proteins and a Western blot using an AaET-specific antibody. Additionally, BApNA kinetic assays of crude lysate from the mutant had no activity compared to the active wild type. Future studies will involve mutating the serine in the catalytic triad to alanine, to prevent auto-activation and degradation.
Poster #: 153
Project Title: Recombinant Protein Expression of AaSPV from the Arbovirus Vector Aedes aegypti Mosquito
Author List:
Perryman, Alexia; Undergraduate, Chemistry, San José State University, Presenting Author
Lee, Mai; Undergraduate, Chemistry, San José State University
Rascon, Alberto; Faculty, Chemistry, San José State University
Abstract: Dengue, chikungunya, and yellow fever viruses are problematic in tropical and subtropical areas due to the ideal climates that can sustain the life cycle of the mosquito. Recently, cases of humans infected with the Dengue and chikungunya viruses have arisen in the Americas, including the United States, implicating a more widespread problem. The female Aedes aegypti mosquitoes are the leading vectors of these arboviruses. The viruses are transmitted to humans during the acquisition of a blood meal as the female mosquito requires nutrients, obtained through the digestion of blood meal proteins, for the egg maturation and egg laying processes. Vital to the female mosquito are digestive enzymes expressed in the mosquito’s midgut responsible for cleaving proteins into amino acids. Blood meal digestion occurs in a biphasic manner as protease activity can be detected 1 to 6 hours post blood meal, known as the early phase, with higher protease activity observed 12 to 36 hours post blood meal, known as the late phase. Aedes aegypti serine protease V, or AaSPV, is believed to be expressed in the Aedes aegypti midgut at fairly constant levels before and after blood feeding, yet the potential role it plays in blood meal digestion is not understood. Other serine proteases from the Aedes aegypti midgut, which are known to be involved in blood meal digestion, contain a His-Ser-Asp catalytic triad; however, the histidine is replaced by a leucine in AaSPV. The presence of the catalytic triad could be a key component in conferring proteolytic activity, so the histidine to leucine substitution in AaSPV obscures its function. Experiments were focused on the isolation and expression of AaSPV. By cloning AaSPV into the pET28a bacterial expression vector, intact plasmids were created that could be transformed into BL21 (DE3) E. coli cells for recombinant protein expression. Low protein expression was observed after induction with Isopropyl β-D-1-thiogalactopyranoside, and the expressed protein was insoluble. Current work is now focused on increasing protein expression in addition to obtaining soluble expressed protein to facilitate purification. The purified AaSPV enzyme will then be studied in vitro to determine if it is a true digestive enzyme and to better understand its role in blood meal protein digestion.
Poster #: 154
Project Title: Influenza nucleoprotein mutants offer structural insight to vRNP formation
Author List:
Ramirez, Jose; Undergraduate, Biology, California State University, San Bernardino, Presenting Author, Nagel Award Finalist
Newcomb, Laura; Faculty, Biology, California State University, San Bernardino
Abstract: Influenza viral ribonucleoprotein complexes (vRNPs) are comprised of the vRNA template, viral RNA dependent RNA polymerase (RdRP), and nucleoprotein (NP). NP serves as the scaffolding and building block in the formation of the vRNP complexes and is integral to transcription and replication of the viral genome. Interactions between NP and both viral and host factors have been implicated in regulating vRNP formation and activity.
Our previous work characterized a nuclear localized N-terminal deletion mutant, termed del20NLS-NP, which was shown to be deficient in viral gene expression but localized in the nucleus and able to bind nucleic acids as well as wild type NP. The N-terminus of NP encodes a nonconventional nuclear localization signal (NLS). In addition, the N-terminus of NP interacts directly with host RNA processing factors UAP56 and URH49. The viral gene expression deficiency in the presence of del20NLS-NP was exacerbated with increased viral template length, suggesting a deficiency in the formation and stability of vRNPs. Blue Native Poly Acrylamide Gel Electrophoresis (BN-PAGE) revealed del20NLS-NP does not form high molecular weight complexes as efficiently as wild type NP, supporting a defect in vRNP formation and/or stability.
Here we present BN-PAGE data with increased resolution of the native protein extracts. These data resolve distinct protein complexes of varied size and reveals smaller and less abundant complexes containing del20NLS-NP compared to wild type NP. This is an improvement over the initial BN-PAGE, which could only resolve formation of larger complexes without distinct sizes. The composition of the different sized native WT-NP and del20NLS-NP containing complexes will be examined though the use of secondary SDS PAGE. The varied high molecular weight complexes will be isolated from the native gel and resolved by SDS-PAGE to examine individual complex composition. Probable constituents of the WT-NP complexes include the subunits of the influenza RdRP (comprised of subunits PB1, PB2, and PA), and host factors such as UAP56 or UHR49. We hypothesize del20NLS-NP vRNPs will be deficient for NP-UAP56 and/or NP-URH49 interaction. Using the combination of BN PAGE and secondary SDS-PAGE, the complexes that form with various NP mutants should provide valuable insight into molecular requirements for the formation and stabilization of influenza vRNPs.
This research is supported by NIH SC3GM099559 to LN and MARC NIH T34GM083883 to JR.
Poster #: 155
Project Title: Reversed allostery of CRP-like-Protein (Clp) from Xanthomonas axonopodis
Author List:
Curiel, Joel; Graduate, California State University, Fresno, Presenting Author
Gunasekara, Sanjiva; Graduate, Biology, California State University, Fresno, Presenting Author
Youn, Hwan; Faculty, Biology, California State University, Fresno
Abstract: CRP-like-protein (Clp), a member of the CRP/FNR superfamily of transcription factors, is a major virulence factor in the citrus plant pathogen, Xanthomonas axonopodis. Clp is homologous to the Escherichia coli cAMP receptor protein (CRP), the model transcription factor, as it has 45% sequence identity. However, this homolog is unique because it functions in an opposite manner to CRP. Unlike CRP, which is activated by cAMP binding, Clp by itself is always active (constitutively active) and is inactivated when bound by the ligand cyclic-di-GMP. To characterize key amino acid residues responsible for the reversed allostery of Clp (constitutive activity of apoClp and inactivation by cyclic di-GMP), we constructed four different chimeric proteins: CRP-Clp_Pro110, CRP-Clp_Phe136, CRP-Clp_Arg142 and CRP-Clp _Pro154 (amino acid numberings are those of CRP). These chimeras differ in their junctions, but all are composed of the N-terminal stretch of amino acids of CRP and the C-terminal stretch of amino acids of Clp. When tested using an in vivo DNA-binding assay, all the chimeric proteins except CRP-Clp_Pro154 showed wild type Clp levels of constitutive activity. The results indicate that between the positions Arg142 and Pro154 there are key residues affording constitutive activity to Clp. Currently, we are testing if the amino acid patch of Arg142-Pro154 is important for cyclic di-GMP binding and response. This study provides a molecular basis for the reversed allosteric transition in Clp.
This research was supported by the NIH Grant #1R15AI101919-01 (to Hwan Youn)
Poster #: 156
Project Title: Regulation of Metabolism by the proto-oncogene Bcl-2: an NMR-based metabolomics study
Author List:
Llanos, Rhaul; Graduate, Chemistry, California State University, Fresno, Presenting Author
Ahmad, Miriam; Undergraduate, Chemistry, California State University, Fresno
Krishnan, Krish; Faculty, Chemistry, California State University, Fresno
Dejean, Laurent; Faculty, Chemistry, California State University, Fresno
Abstract: Dramatic changes in energy metabolism fuel cancer’s development and progression. Perhaps the best studied of these phenomena is the Warburg effect, which corresponds to an increase of anaerobic glycolysis vs mitochondrial oxidative phosphorylation to produce energy for cellular processes. However, the mechanisms related to these metabolic switches are still a matter of debate. Certain studies indicate that Bcl-2 may play a role in these metabolic changes. Bcl-2 family proteins contain both pro- (e.g. Bax), and anti-apoptotic (e.g. Bcl-2) members which are respectively encoded by tumor suppressors and proto-oncogenes. Interestingly, our preliminary results indicate that Bcl-2 overexpression in a mouse pro-lymphocyte B cell line led a significant increase of the specific activity of the fermentative enzyme lactate dehydrogenase. This effect was much diminished if a Bcl-2 mutant incapable of interacting with Bax (Bcl-2-G145E) was used instead of native Bcl-2. Nuclear magnetic resonance (NMR) spectroscopic based metabolomics analysis provides a holistic approach to changes in metabolic pathways. In this study, we obtained 1H-NMR spectra from Parental, Bcl-2- and Bcl-2-G145E FL5.12 cell lines. These untreated samples show significant differences in the profiles of the NMR spectra; one of the affected signals seeming to more specifically reflect changes at the level of the metabolic step catalyzed by the succinate dehydrogenase (i.e. accumulation of fumarate). In a near future, monitoring of the conversion of stable isotope-labeled glucose will provide profound insights into the metabolic dynamics and enables the tracking of individual carbon routes within carbohydrate metabolism. Specifically, the analysis of stable isotope incorporation can be used to determine the dynamics of metabolic circuitries that are altered due to of Bcl-2 overexpression. Completion of these aims will help define a more integrated picture of the pathway(s) connecting Bcl-2 and fuel metabolism; and should provide clues for new strategies in therapeutics against blood cancer such as Non-Hodgkin’s lymphoma.
Poster #: 157
Project Title: Biophysical analysis of lipid free and lipid associated apoE3, an anti-atherogenic exchangeable apolipoprotein
Author List:
Kothari, Shweta; Graduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Nguyen, Patricia; Undergraduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Hernandez, Roy; Graduate, Chemistry and Biochemistry, California State University, Long Beach
Narayanaswami, Vasanthy ; Faculty, Chemistry and Biochemistry, California State University, Long Beach
Abstract: Apolipoprotein E3 (apoE3) is a major plasma cholesterol transport protein. It is considered anti-atherogenic because of its ability to mediate cellular uptake of lipoproteins via the low-density lipoprotein receptor (LDLr) family of proteins. It is a 299 residue apolipoprotein made up predominantly of amphipathic α-helices; it has the ability to exist in lipid-free and -bound states, and undergoes a conformational change as it transitions between the two states. Lipid-free apoE3 is composed of two domains: a 4-helix bundle N-terminal (NT) domain bearing binding sites for LDLr, and, a C-terminal (CT) domain bearing protein tetramerization and high affinity lipid-binding sites. We hypothesize that upon lipid binding the two domains undergo an ordered opening initiated at the terminal ends of the protein and finally attain an extended helical conformation in the lipid-associated state. We tested the hypothesis using site-specific fluorescence labeling and cross-linking analysis of recombinant human apoE3 bearing single Cys at defined sites to monitor helices (H1-H4 in NT and C1-C3 in CT domain). The single Cys constructs were labeled with fluorophores and subjected to chemical-induced denaturation and fluorescence polarization analysis to determine probe mobility. Our data indicate that: (i) the CT domain unfolds prior to NT domain; (ii) the order of unfolding of the CT domain is C1/C2 followed by C3, while that of the NT domain follows the order: H4/H3, H2 and H1. Further, single Cys apoE3 variants were used to prepare reconstituted HDL. Cross-linking analysis revealed dimeric bands indicative of spatial proximity between neighboring apoE molecules in lipid-associated state. This was independently confirmed by pyrene fluorescence spectroscopy, which provides information about spatial proximity of fluorophores. Together, our studies suggest that the two domains of apoE3 undergo conformational reorganization, wherein the CT domain initiates binding, and the NT 4-helix bundle undergoes opening with the helices moving apart from each other in an ordered fashion. In the HDL-bound state, apoE3 helices appear to be aligned adjacent to each other in a parallel orientation shielding the hydrophobic portion of the lipid bilayer. Our study offers mechanistic insight into lipid binding interaction of apoE and its conformation on HDL. This project is supported in part by NIH GM105561, 2014 CSUPERB Howell award and 2013 McAbee-Overstreet Graduate Research Scholarship
Poster #: 158
Project Title: Identification of accessory target proteins of antibacterial inhibitors using target identification platform for antibacterials version 2 (TIPA II)
Author List:
Martinez, Walfre; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Jefferson, Jameka; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Ward, Matthew; Graduate, Biological Sciences, California State University, Los Angeles
Xu, Howard; Faculty, Biological Sciences, California State University, Los Angeles
Abstract: Background: Spread of multidrug resistant bacterial pathogens has rendered most antibiotics ineffective, highlighting the need for the discovery of new antibiotics. We previously validated a target identification platform for antibacterials (TIPA) by employing a collection of 270 Escherichia coli clones each over-expressing a single essential gene. To increase its sensitivity, we recently established TIPA II using an E. coli outer-membrane mutant. We hypothesize that TIPA II assay can be employed to identify accessory targets of antibacterial inhibitors. Thiolactomycin was known to target beta-ketoacyl ACP synthase I (FabB) while D-cycloserine has been demonstrated to target two enzymes involved in peptidoglycan synthesis: alanine racemase (Alr) and D-alanine:D-alanine ligase (Ddl). To test our hypothesis, we employed TIPA II assay in identification of targets of these two inhibitors. Methods: The 277 clones in E. coli AS-19 host cells were configured into six mixed pools. The TIPA II assays were then carried out by individually incorporating each of the mixed pools into molten top agar on the surface of LB agar medium with and without inducer. Sterile filter disks were placed on the plates and were impregnated with an inhibitor solution. After growth, resistant colonies or growth rings emerged within the zones of inhibition were isolated and characterized genetically by DNA sequencing. Results: Among 43 resistant colonies isolated from induced plate surrounding the thiolactomycin disk, 25 colonies were found to contain plasmid-borne fabB gene. To our surprise, 18 additional colonies harbor a plasmid containing acpP gene. For D-cycloserine test, among 22 resistant colonies isolated from induced plate overlaid with mixed Pool #1, 12 were found to harbored plasmid-borne murC gene. Similarly, out of 22 resistant colonies isolated from induced plate overlaid with mixed Pool #4, 14 colonies containing plasmids with murB gene as inserts. Conclusion: Our TIPA II assays not only identified known target of an antibacterial inhibitor (FabB for thiolactomycin), but also identified accessory targets for inhibitors (AcpP for thiolactomcyin, MurB and MurC for D-cycloserine), thus revealing additional dimension of the mechanisms of action for these inhibitors. Acknowledgements: Funding for this project was provided by a grant (W911NF-12-1-0059) from the Army Research Office and a grant (5R25GM061331) from NIH.
Poster #: 159
Project Title: Bacterial Recombinant Protein Expression of AaSPVI Protease Gene from the female virus vector Aedes aegypti mosquito.
Author List:
Kang, Tejpal; Undergraduate, Chemistry, San José State University, Presenting Author
Rascon, Alberto; Faculty, Chemistry, San José State University
Abstract: The primary vector for the Dengue fever, yellow fever, and chikungunya viruses is the female Aedes aegypti mosquito. Although these viruses are endemic to the tropic and sub-tropic regions of Asia, South America, and Africa, due to climate change, cases of Dengue fever and chikungunya are being reported in the United States. The female Aedes aegypti mosquito requires a blood meal in order to obtain the nutrients needed to complete the gonotrophic cycle (the blood feeding and egg laying process). The blood feeding process is how viruses spread to human hosts as it is transmitted via the mosquito salivary glands. Once the mosquito has acquired a blood meal, proteases are released into the midgut to aid the digestion of blood meal proteins. These proteases are expressed at different time-points post blood meal and are crucial in providing nutrients for egg production. The overall goals of our research project are to understand and characterize the individual proteases involved in the digestion of blood meal proteins and develop inhibitors against these proteases. Inhibition of these proteases may reduce the fecundity of the mosquito thereby reducing the spread of the Dengue fever and chikungunya viruses. We are focusing on Aedes aegypti serine protease VI (AaSPVI), which is a late-phase protease involved in midgut blood meal digestion. Using recombinant DNA technology the inactive zymogen form of AaSPVI was cloned into the pET28a bacterial expression vector. The AaSPVI plasmid was then expressed using Turbo BL21(DE3) competent cells; however, the protein was expressed insolubly. In order to improve expression and allow proper folding of the protein, T7 Shuffle competent cells were used. The T7 Shuffle competent cells provide a more oxidizing environment, which aids in proper disulfide bridge formation and protein folding. After conducting a growth experiment and inducing the cells with IPTG, SDS-PAGE results showed improved expression of soluble zymogen AaSPVI, and surprisingly, auto-activation. Preliminary BApNA activity assays of samples collected from the T7 shuffle growth experiment confirmed these results. We are now focusing on inactivating AaSPVI by mutating the protease at the propeptide cleavage region and the active site in order to understand the mechanism of auto-activation. In addition, we will biochemically study the protease in vitro to validate AaSPVI as an inhibitor target.
Poster #: 160
Project Title: Development of Reconstituted HDL Containing Apolipoprotein E3 for Transport and Delivery of Luteolin, an Anti-inflammatory Agent
Author List:
Cruz, Siobanth; Undergraduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author, Nagel Award Finalist
Narayanaswami, Vasanthy; Faculty, Chemistry and Biochemistry, California State University, Long Beach
Abstract: Luteolin, a flavone, inhibits proinflammatory enzymes and inflammatory cytokine release in macrophages. By incorporating luteolin into HDL with human apolipoprotein E3 (apoE3) we aim to transport luteolin through aqueous environments and to specific intra-cellular locations in a targeted and specific manner. To achieve this, we will use high density lipoproteins (HDL) bearing apoE3 as a “nanovehicle” to load and transport luteolin.
Reconstituted HDL (rHDL) was prepared by combining phospholipids and recombinant human apoE3(1-191) in the absence or presence of luteolin. Lipoprotein complexes were separated form lipid-free protein and protein-free lipid vesicles by density gradient ultracentrifugation. Fluorescence spectroscopy was carried out to determine the presence of luteolin in rHDL taking advantage of the intrinsic fluorescence properties of luteolin; a blue shifted emission peak was observed at 486 nm confirming luteolin incorporation into rHDL. SDS-PAGE analysis revealed a 24 kDa band in rHDL preparations with or without luteolin indicative of the presence of apoE3(1-191). Non-denaturing PAGE of rHDL showed the formation of large lipoprotein complexes between 400 – 700 kDa. Functional analysis on rHDL showed that the presence of luteolin did not affect the LDLr binding ability of apoE3. Taken together, we demonstrate successful incorporation of luteolin into rHDL containing apoE3 without compromising the LDLr binding function of apoE3. The significance of this study is that rHDL may be an effective transporter of luteolin in the plasma and across cell membranes.
This project was funded by NIH Grant # HL096365 and GM105561
Poster #: 161
Project Title: The molecular mechanism of the interaction between Hsp70s and lipids
Author List:
Kdeiss, Brianna; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Bilog, Andrei; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Nguyen, Peter; Undergraduate, Biological Science, California State University, Fullerton
McCallister, Chelsea; Graduate, Biological Science, California State University, Fullerton
Nikolaidis, Nikolas; Faculty, Biological Science, California State University, Fullerton
Abstract: Seventy-kilodalton heat shock proteins (Hsp70s) are molecular chaperones essential for maintaining cellular homeostasis and survival. These proteins prevent protein aggregation, refold misfolded proteins, and transport proteins along membranes and subcellular compartments. Apart from their indispensable roles in protein homeostasis specific Hsp70s localize at the plasma membrane, associate with lipid-rafts, and bind to specific lipids. The interaction of Hsp70s with lipids has direct physiological outcomes including activation of the immune system, viral entry, lysosomal rescue, microautophagy, and promotion of cell apoptosis. Despite these essential functions the Hsp70-lipid interactions remain largely uncharacterized. We have recently determined the binding affinities of recombinant HSPA1A and HspA8, the major cytosolic Hsp70s in human, to several negatively charged phospholipids. In this study, we characterized some of the molecular determinants of the HSPA1A-lipid interaction aiming to establish the molecular mechanism of this interaction. We first established that although the nucleotide-binding domain (NBD) of the protein is largely responsible for lipid-binding and the substrate-binding domain (SBD) does not directly bind to lipids, allosteric communication between the two domains is important for lipid-binding. We then determined that a conformational change caused by nucleotide-binding reduces lipid-binding for a particular subset of lipids, while binding of protein substrates has no effect on the lipid-binding. Next, we used medium concentrations of calcium and determined that the HSPA1A-lipid interaction is not purely electrostatic but it also depends on other forces. Furthermore, we used high concentrations of potassium and found that HSPA1A embeds in membranes when bound to specific lipids, such as phosphatidylserine. We also established that protein embedding occurs via the SBD region of the protein. Based on these data we propose a model according to which the NBD domain of HspA1A contains two lipid binding sites, the first one targets and docks the protein to the membrane, while the second one facilitates the embedding of the SBD into the non-polar interior of the membrane. These results uncover the mechanistic details of the Hsp70-lipid interactions and establish a framework of possible physiological functions of these interactions as they relate to chaperone regulation and localization.
Poster #: 162
Project Title: Functional Characterization of naturally occurring Hsp70 variants in humans
Author List:
Hess, Kyle; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Nguyen, Peter; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Bilog, Andrei; Undergraduate, Biological Science, California State University, Fullerton
Siracusa, Matthew; Undergraduate, Biological Science, California State University, Fullerton
Nikolaidis, Nikolas; Faculty, Biological Science, California State University, Fullerton
Abstract: A fundamental question in molecular evolution is how changes at the DNA level affect the way organisms adapt to their environments, cope with changes and challenges, and survive. At the cellular and sub-cellular levels the same essential question relates to the ability of cells to adapt and survive alterations of their homeostasis due to stress, like heat shock, oxygen radicals, heavy metals, infection, and disease, by modifying their stress response systems. Molecular chaperones and in particular the 70-kD heat shock proteins (Hsp70s) are key regulators of these cellular stress response systems and alterations in their function have direct physiological consequences. Therefore, it is of paramount importance to determine how natural mutations alter the function of Hsp70s and how these changes affect cell survival. To shed light to this important question we used multiple natural single nucleotide polymorphisms (SNPs) found on HSPA1A, the major stress inducible Hsp70 gene in humans, and determined whether these mutations alter protein function. Specifically, the wild-type (WT) HSPA1A sequence was subcloned into both bacterial and mammalian expression vectors and the mutated gene variants were generated using site directed mutagenesis. Recombinant proteins corresponding to the WT and mutated variants were then generated and tested for their ability to hydrolyze ATP. Based on the Km values obtained, the WT had the highest affinity for binding to ATP, but based on the Vmax values, some mutants were able to hydrolyze ATP at a much faster rate. The different affinities for both ATP and ADP were verified using Isothermal titration calorimetry (ITC), which also revealed differences in the reaction entropy. The mutant proteins’ ability to properly localize intracellularly within mammalian cells was also tested by tagging HSPA1A to GFP, using fluorescent dyes to stain the mitochondria, lysosomes, and plasma membrane, and viewing where the proteins localized via confocal microscopy. These results revealed that the mutants and the WT protein had similar subcellular localization. However, live-dead and cell proliferation assays revealed that some of these mutations significantly change cellular survival after heat stress. Given that these natural variants are either population-specific or clinical we suspect that the observed functional differences alter the ability of cells and the individuals carrying them to cope with stress or disease.
Poster #: 163
Project Title: Stabilization of Protein Folding Due to Desolvation Energy Effect
Author List:
Gancayco, Marc; Undergraduate, Chemistry, San José State University, Presenting Author
Eggers, Daryl; Faculty, Chemistry, San José State University
Abstract: Using circular dichroism spectrometry, the structural stability of alpha-lactalbumin as a function of its own concentration was determined by monitoring changes in tertiary structure (molar ellipticity) in the near UV range. As absorbance is dependent on the concentration and path length, the path length was decreased as protein concentration increased to maintain the same total absorbance. In this way, changes in the molar ellipticity could be ascribed to changes in the ratio of folded to unfolded protein. These experiments are motivated by a thermodynamic equation developed in our laboratory which predicts the desolvation energy of folding will favor the native structure more as the total concentration of protein increases. In order to test our equation, the structure of alpha-lactalbumin was destabilized using 3 M guanidine hydrochloride such that concentration dependent changes in the tertiary structure of α-lactalbumin could be observed at 25 ºC. We observed an increase in native tertiary structure as the protein concentration increased. This model is one of the first experimental approaches to treat the free energy of bulk water as a variable and to acknowledge that the ratio of products to reactants (K) is not constant for protein folding equilibria.
This project is funded in part by the NIH MARC U-Star Program at SJSU (5T34GM008253-27) and by a past NIH SC3 award to DKE (GM089591).
Poster #: 164
Project Title: The Role of Non-Catalytic Cysteine Residues in Controlling the Sensitivity of Protein Tyrosine Phosphatases to Oxidation
Author List:
Bartleson, Juliet; Undergraduate, Biology, Sonoma State University, Presenting Author
Yoast, Ryan; Undergraduate, Biology, Sonoma State University, Presenting Author
Fukuto, Jon; Faculty, Chemistry, Sonoma State University
Lin, Joseph; Faculty, Biology, Sonoma State University
Abstract: Protein tyrosine phosphatases (PTPs) are important in a multitude of signaling pathways. All PTPs contain a catalytic cysteine residue within their active site, which is essential for phosphatase activity. Importantly, the thiol group (R-SH), of the catalytic cysteine must be in the reduced state to confer phosphatase activity. Because of this unique biochemical property, cysteine residues are vulnerable to oxidation. Under mild oxidative conditions, cysteines can readily form disulfide bonds with other cysteines (R-S-S-R’) or be converted into the sulfenic acid (R-S-OH), both of which are reversible with the cellular reducing agent glutathione (GSH). However, under more extreme oxidizing conditions, the sulfenic acid can be further oxidized to the sulfinic or sulfonic acid, which is not reversible by GSH. Notably, the disulfide cannot be further oxidized which can be viewed as a protective mechanism under extreme oxidizing conditions.
In this study, we investigate the role of non-catalytic cysteines in controlling the sensitivity of the PTP, CD148, to oxidation. Previous studies with other PTPs have shown that some non-catalytic cysteines can form disulfide bonds with the active site cysteine protecting it from irreversible oxidative states. To test this hypothesis, we mutated two non-catalytic cysteines in the phosphatase domain of CD148 that, based on the predicted structure, could form disulfide bonds with the catalytic cysteine. The mutated PTPs were then expressed in E. coli and purified. Finally, the PTPs were treated with varying concentrations of hydrogen peroxide, a potent oxidant, and then reduced with varying concentrations of GSH and assayed for their enzymatic activity using an exogenous substrate. By taking this structure-function approach, we hope to better understand the role non-catalytic cysteines play in controlling the sensitivity of CD148 to oxidation.
Poster #: 165
Project Title: Characterization of the Functions for Qscr and Oxh in the Operation of the Oxalyl-CoA Reductase Pathway in Methylobacterium extorquens AM1
Author List:
Camacho, Beatriz; Undergraduate, Biological Sciences, San José State University, Presenting Author
Van Fosson, Julie; Undergraduate, Biological Sciences, San José State University
Skovran, Elizabeth; Faculty, Biological Sciences, San José State University
Abstract: Methylobacterium extorquens AM1 is a model organism for the study of methylotrophic growth and is of interest as a platform for production of value added chemicals like biofuels and biodegradable plastics from methanol. When M. extorques is grown using single carbon compounds, it uses the Ethylmalonyl-CoA (EMC) pathway to produce glyoxylate, a metabolite required for carbon assimilation through the Serine Cycle. EMC pathway intermediates are precursors for biofuel and bioplastic production, but sequestration of these intermediates limits the cell’s ability to grow. Recently the Oxalyl-CoA Reductase (OCR) pathway was shown to also produce glyoxylate under certain conditions. This pathway is encoded in an operon and consists of an oxalate formate antiporter, an oxalyl-CoA synthetase, an oxalyl-CoA reductase and a hydrolase of unknown function. Use of the OCR pathway for glyoxylate production may allow intermediates from the EMC pathway to be incorporated into value added chemicals without decreasing the levels of glyoxylate required for methylotrophic growth. The focus of this work is to understand the operation and regulation of the OCR pathway to facilitate strain engineering. Transposon mutagenesis identified the Serine Cycle regulator, QscR, as a potential transcriptional activator of this pathway. To test if regulation by QscR is direct or indirect, His-QscR was purified and direct binding to the promoter region of the OCR pathway operon was confirmed using gel electrophoresis mobility shift assays. One question that remains is the function of the putative hydrolase encoded in the OCR pathway operon. M. extorquens produces intracellular oxalate, however the source of the oxalate is unknown. One possibility is that the hydrolase functions as an oxaloacetate hydrolase producing oxalate and acetate, an activity found in some fungi. This activity was assayed for cell free extracts but was not detected, possibly due to the high background at the absorbance used to detect oxaloacetate (255 nm). To test if oxaloacetate hydrolase activity can be detected in vitro, the putative hydrolase was cloned into a His-tagged expression construct. Future studies will focus on the purification of this enzyme and determination of its role in the OCR pathway. The findings from these studies may aid the ability to engineer M. extorquens AM1 to produce value added chemicals derived from EMC pathway intermediates without sacrificing cellular growth.
Poster #: 166
Project Title: Aminoglycosides Enhance Tenebrio molitor Antifreeze Protein Activity
Author List:
Morita, Alexander; Graduate, Chemistry and Biochemistry, California State University, Los Angeles, Presenting Author
Bagdagulyan, Yelena; Undergraduate, Biological Sciences, California State University, Los Angeles
Arifin, Josh; Undergraduate, Chemistry and Biochemistry, California State University, Los Angeles
Wen, Xin; Faculty, Chemistry and Biochemistry, California State University, Los Angeles
Abstract: Antifreeze proteins (AFPs) are found in a variety of organisms, including fish, insects, fungi, and bacteria. They protect these organisms from freeze damage in the winter by binding to growing ice crystals and preventing their growth in a non-colligative manner, depressing the freezing point of water. They do not affect the melting point of water, so the difference between the depressed freezing point and the melting point is termed thermal hysteresis (TH). The AFPs with most antifreeze activity have been found in insects, and AFPs from the fire-colored beetle Dendroides canadensis (DAFPs) and mealworm beetle Tenebrio molitor (TmAFPs) have been studied in our group. They share 60% amino acid sequence homology and share a common right-handed beta-helical structure and share an ice-binding site with a Thr-X-Thr motif. In previous studies with DAFP-1 we have showed that polycarboxylates and polyhydroxy compounds enhanced the TH activity of the protein significantly by as much as fourfold, and it was demonstrated that the arginine residues had a major role in the activity enhancement. TmAFP does not contain arginines. In this work, we focused on the role of aspartic acids in the antifreeze enhancement of TmAFP and hypothesized that polycationic compounds such as aminoglycosides may enhance the TH activity of this protein. Differential scanning calorimetry (DSC) has been used in previous studies to measure the TH activity for AFPs. We utilized this method by testing the TH activity of the protein itself, known efficient enhancers of DAFP-1 with the protein, and the protein with aminoglycosides. The results we obtained from the DSC indicate that efficient enhancers for DAFP-1 did not work as well for TmAFP, showing that arginine is critical for AFP TH enhancement with polycarboxylates and polyhydroxy compounds. In contrast, aminoglycosides such as kanamycin, gentamicin sulfate, neomycin, and gentamicin-HCl at relatively low concentrations increased the TH activity of TmAFP by nearly two fold. Discovering enhancers for TmAFP or other AFPs could help explain their mechanism of action and potentially further their use as cryoprotectants.
Acknowledgements
We thank Dr. Peter Davies at Queen’s University, Canada, for providing the cDNA of TmAFP and National Institutes of Health Grant GM086249 for supporting the study. X. W. and J. A. thank Undergraduate Research Mentoring Awards from CETL CSULA.
Poster #: 167
Project Title: Profiling folate metabolite derivative levels in Ixodes pacificus ticks using LC-MS/MS
Author List:
Kirby, Cheyenne; Undergraduate, Biology, Humboldt State University, Presenting Author
LaCourse, Monique; Undergraduate, Biology, Humboldt State University, Presenting Author
Chen, Junyan; Undergraduate, Biology, Humboldt State University
Zhong, Jianmin; Faculty, Biological Sciences, Humboldt State University
Abstract: With the dramatic rise in tick borne disease occurrence and the current methods of control primarily chemical based, it is important to research alternative means of control such as manipulating an existing symbiotic relationship. Several species of ticks in genus Ixodes harbor bacterial species, some of which cause Lyme disease and Rocky Mountain spotted fever. In particular, Ixodes pacificus is host to nonpathogenic Rickettsia endosymbiont phylotype G021, which are transmitted from generation to generation transovarially and transstadially with 100% efficiency. We believe the basis for this symbiotic relationship is to enrich the tick’s nutrient poor mammalian blood diet by synthesizing folate for the tick. In order to supplement current research aimed at proving transcription of these folate genes in vitro and in vivo, biosynthesis of folate is quantified with liquid chromatography tandem mass spectrometry (LC-MS/MS). The following folate derivatives have been successfully detected in field collected tick samples: tetrahydrofolate, 5-Formyl-tetrahydrofolate, and 5-Methyl-tetrahydrofolate. However, further method development is needed to increase the accuracy due to degradation and interference in the samples. To further investigate our hypothesis, folate will be quantified from uninfected, infected, and antibiotic treated tick cell culture as well as unfed and fed field collected ticks from each life stage.
This research is funded by NIH grant 1R15AI82515-01.
Poster #: 168
Project Title: Expression of Soluble Pseudo-nitzschia Prenyltransferase in E. coli by Induction after Cold Shock
Author List:
Bui, Ha; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Grant, Marcus; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Flores, Michael; Undergraduate, Chemistry, California State University, Sacramento
Savage, Thomas; Faculty, Chemistry, California State University, Sacramento
Abstract: Domoic Acid (DA) is a neurotoxin synthesized by marine diatoms of the genus Pseudo-nitzschia. DA accumulates during algal blooms which may be stimulated by anthropogenic factors. To understand how environmental factors stimulate DA biosynthesis at the molecular level, we are trying to isolate genes encoding DA biosynthetic enzymes. Precursor feeding studies suggest DA is derived from geranyl diphosphate (GDP) and glutamate. Enzymes that catalyze the formation of GDP are likely homologous to prenyltransferases in other organisms that catalyze similar reactions. Six prenyltransferase homologs have been identified in Pseudo-nitzschia, but it is unclear which one encodes the enzyme that forms GDP. The cDNA for one of these prenyltransferases was cloned and transformed into E. coli to generate protein to assay for GDP synthase activity. However, initial E. coli expression experiments were unsuccessful in producing properly folded soluble protein, but instead produced catalytically-inactive insoluble inclusion bodies. In this study we changed expression conditions in an attempt to slow down production and allow for proper folding of the expressed prenyltransferase, either by lowering the concentration of the inducer or by quickly reducing the temperature before expression. We demonstrate that reducing the temperature, but not lowering inducer concentration results in expression of soluble catalytically-active protein.
Poster #: 169
Project Title: Chemical Characterization of Phytoliths with Raman Spectroscopy: What is inside?
Author List:
Sanchez, Jessica; Undergraduate, Psychology, California State University, Fullerton, Presenting Author
Alfonso Garcia, Alba; UCI Department of Chemistry
Gallagher, Kimberley; UCI Department of Earth Systems Science
Potma, Eric; UCI Department of Chemistry
Harutyunyan, Araks; UCI Department of Earth Systems Science
Santos, Guaciara; UCI Department of Earth Systems Science
Abstract: Phytoliths are silica bodies formed by biomineralization in plants where soluble monosilicic acid is assimilated by the plant and precipitated within the cells and intracellular spaces as amorphous silica. After the plant dies and decays, phytoliths remain in the soil until they are slowly released to soil solution through chemical weathering. Phytoliths contain a small amount of carbon (phytC) embedded in the silica bodies. Morphology and distribution patterns of phytoliths in soils have been used for paleoenvironmental reconstructions, when the assumption that the embedded carbon (C) has a photosynthetic origin led to several isotopic studies. However, systematic offsets of the radiocarbon (14-C) age of phytC relative to the 14-C age of the plant tissue prompted the investigation of its C source (Santos et al. 2012). This study uses Raman spectroscopy to examine the nature of phytC obtained from a previous isotope study (Santos et al. 2014, abstract presentation). The phytoliths were isolated from modern plants, Sorghum bicolor, growing in six different experimental conditions, attempting to see if phytC changes with different growing conditions. Differences in organic matter type and distribution between these treatments could give information about the organic matter source. Samples of bilobate phytoliths were analyzed in the C-H stretching region (2700-3200 cm^-1) and the fingerprint region (1300-1800 cm^-1) of the vibrational spectrum. Results show that the average spectra for each treatment exhibit consistent common vibrational bands; however there are slight differences between the spectra of phytoliths from each treatment. The data suggest the presence of carbohydrates, lignin, and possibly lipids. Moreover, the organic matter is heterogeneously distributed throughout the phytoliths, corroborating the findings of Alexandre et al. (2014). Further research will focus on spectral imaging and a Raman based survey of other silica structures. Information on the nature of organic matter in phytoliths may aid in determining a mechanism of entrapment.
Poster #: 170
Project Title: Development of a Pneumatically Powered Platform for Vertical Displacement of the Walking Surface: A Preliminary Analysis
Author List:
Nessler, Jeff; Faculty, Kinesiology, California State University San Marcos, Presenting Author
Heredia, Severne; Undergraduate, Kinesiology, California State University San Marcos, Presenting Author
Abstract: Sensory-motor synchronization in humans is a relatively new area of study that may have application in the rehabilitation of gait for multiple patient populations. While most interventions have utilized visual and auditory cues to achieve training effects, existing evidence suggests that mechanical input may have a stronger effect on walking behavior. PURPOSE: The purpose of this project is to design and build a platform that can be used to provide this type of mechanical input through subtle movement of the walking surface. Here we present the first preliminary data regarding subconscious synchronization of walking to a vertically oscillating treadmill. METHODS: Six subjects completed 8 walking trials, each 2 minutes in duration. For the first trial, all subjects walked at 2.4mph while the treadmill was held stationary in order to provide an estimate of the subject’s preferred stride frequency. The remaining 7 trials were performed while the platform oscillated vertically with a consistent amplitude of 1 inch and a frequency that was varied systematically between ±10% of the subject’s preferred frequency. A motion capture system was used to record subject and treadmill movement and an overhead harness was provided to ensure subject safety. RESULTS: Stride synchronization to platform movement varied greatly across conditions (70±28% vs 15±1% frequency locking), but in general occurred most reliably when the frequency of platform oscillation was closest to each subject’s preferred value. In addition, changing the frequency of oscillation resulted in changes to stride length, height and duration, though these changes were not statistically significant. CONCLUSIONS: These data demonstrate that subjects will synchronize subconsciously to treadmill movement, but the limits of this behavior appear to be sensitive to deviations from preferred stride frequency. Further, this paradigm is effective at inducing changes in both the magnitude and consistency of multiple aspects of gait, which may have application in rehabilitation. This work was supported by NIH 5SC3GM096900-02.
Poster #: 171
Project Title: Detecting Copper, Iron, and Zinc Accumulation and ROS Generation in Drosophila S2 Cells Using Luciferase Reporters
Author List:
Arbaiza, Jocelyn; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Crisanto, Teodulo ; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino, Presenting Author
Doyle, Janelle ; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Holmes, Jacob ; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Hudson, Zakkary ; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Quezada, Alejandra ; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Rangel, Geovanni; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Ynfante-Corral, Maressah ; Undergraduate, Chemistry and Biochemistry, California State University, San Bernardino
Abstract: The goal of our project is to construct and test biosensors that can detect metal uptake and ROS formation in Drosophila S2 cells. We chose these cells because they have been shown to express a divalent metal ion transporter that can transport metals such as Cu. The motivation for this project comes from a number of recent studies that suggest accumulation of excess metals in cells can cause an increase in the production of reactive oxygen species (ROS) that are implicated in many diseases, including cancer and neurodegenerative disorders. In order to create these DNA biosensors, we used two different metal-responsive promoters (CUP1 and metallothionein) and two different ROS-responsive promoters (hsp22 and SOD) and linked them to firefly and Renilla luciferase reporter genes, respectively. Next, we wanted to test the idea that when the metals are taken up by the cells and ROS is produced, the luciferase genes from our reporter constructs will be expressed and give a luminescent signal. To test for this, we introduced these constructs individually into cultured S2 cells by transfection and treated them with different concentrations of Cu (500 µM and 1500 µM), Fe (100 µM and 300 µM), and Zn (100 µM and 300 µM). After treatment for 16 hours, the cells were assayed for firefly and Renilla luciferase activities. In this study, we observed that the CUP1 reporter produced very little luminescence in response to Cu and Zn and no response to Fe. In comparison, the metallothionein reporter yielded luminescence in response to all three metals and showed an ~89- and ~9-fold higher response to Cu and Zn, respectively. For both the hsp22 and SOD reporters, we observed small luminescent increases in response to Cu. However, the two ROS reporters responded differently to Fe and Zn. The luminescence signal generated by the SOD reporter in response to Fe and Zn was higher (~57- and ~55-fold, respectively) than that of the hsp22 reporter. We conclude from this study that the metallothionein reporter can be useful in measuring intracellular Cu accumulation in S2 cells, and that Fe and Zn may be more potent inducers of ROS than Cu.
This project was supported by the CSUSB PRISM Program (NSF DMS-1035120).
Poster #: 172
Project Title: Microfluidic synthesis of bioconjugated lipid polymer hybrid nanoparticles for targeted drug delivery
Author List:
Takami, Eri; Graduate, Biomedical Engineering , San José State University
Abstract: In recent years, lipid-polymer hybrid nanoparticles have gained attention as a novel drug delivery device for efficient treatment of various diseases such as cardiovascular disease, tuberculosis, and cancer. Functionalized lipid polymer nanoparticles are capable of eluting desired concentrations of drug in targeted areas of the body for lengthy periods of time, maximizing the efficacy of the treatment. Currently, the most common synthesis method is the single step nanoprecipitation method. This synthesis method, however, relies on crude mixing of lipid and polymer particles for nanoparticle formation, which creates inconsistency in lipid-polymer nanoparticle size. Here we developed a microfluidics device to mix lipid and polymer solvents in a controlled manner to synthesize uniformly sized lipid polymer nanoparticles. The microfluidics device consists of three inlet channels, which flows lipid and polymer solutions at a desired flow rate and volume. Dynamic light scattering results of the synthesized nanoparticles show a larger fold in number of nanoparticles produced within the range of 100 to 150 nm in diameter compared to the traditional synthesis method. The microfluidics device can be customized to synthesize nanoparticles of different size, material, and encapsulated drug. The production of higher quality nanoparticles in an efficient manner using our microfluidics device can expedite the research and development process of drug delivering lipid polymer nanoparticles.
Poster #: 173
Project Title: Function and mechanism of Cripto/oep in stem cells and tissue regeneration
Author List:
Arellano-Garcia, Caroline; Undergraduate, Biology, California State University, Northridge, Presenting Author
Alvarez, Gabriela; Undergraduate, Biology, California State University, Northridge, Presenting Author
Booker, Evan; The Salk Institute for Biological Studies
Hoover, Malachia; Graduate, Biology, California State University, Northridge
Agajanian, Megan; Graduate, Biology, California State University, Northridge
Fisher, Wolfgang; The Salk Institute for Biological Studies
Panopoulos, Athanasia; Notre Dame University
Gray, Peter; The Salk Institute for Biological Studies
Kelber, Jonathan; Faculty, Biology, California State University, Northridge
Abstract: Stem cells govern the development, maintenance and regeneration of tissues in vertebrates and their dysregulation is associated with many diseases. However, the molecular mechanisms that drive these stem cell-mediated processes remain to be fully elucidated. The epidermal growth factor (EGF)-Cripto/FRL1/cryptic (CFC) family consists of cell-surface GPI-anchored proteins identified in vertebrate species as required for proper embryonic development or tissue homeostasis and cancer progression in the adult. EGF-CFC proteins function as coreceptors for transforming growth factor-beta (TGFbeta) ligands and can activate mitogenic pathways via Src kinase. Our previous work characterized the mechanisms by which the mammalian EGF-CFC protein Cripto regulates TGFbeta signaling, and we demonstrated that the glucose-regulated protein 78 (hspa5/GRP78) has novel cell-surface functions as an essential Cripto cofactor. Taking a multi-disciplinary approach, we evaluated the role of Cripto, GRP78 and novel Cripto-binding proteins in stem cell-mediated wound healing and tissue regeneration using zebrafish and mammalian cell culture. We discovered that oep (zebrafish homolog of Cripto) levels are significantly upregulated during the first 48 hours after zebrafish caudal fin amputation, followed by a rapid decline by 96 hours. In agreement with a role for oep during stem cell-mediated wound healing, we report that Cripto overexpression in mammary epithelial cells decreases cell adhesion while increasing single cell migration and monolayer wound healing. Interestingly, Cripto blockade in embryonic stem cells only partially abrogates proliferation indicating that other factors may be involved in this process. Supporting our previous work, hspa5 expression follows that of oep during zebrafish caudal fin regeneration. Additionally, cell-surface Cripto and GRP78 are required for iPSC migration, colonization and reprogramming. Finally, cleavage of GRP78 by the AB5 Subtilase Cytotoxin blocks Cripto/GRP78 binding and Cripto-dependent signaling in stem cells. To look for novel Cripto-binding proteins, that may be important for its role in stem cell behavior, we immunoprecipitated Cripto from mammary epithelial cells and found 4 novel proteins with previously characterized roles in wound healing and actin cytoskeleton organization. Future studies will evaluate mechanisms by which these novel proteins regulate Cripto/oep during stem cell-mediated wound healing and tissue regeneration.
Poster #: 174
Project Title: Reduction of Feedback Inhibition in Homoserine Kinase (ThrB) enhances the L-Threonine Biosynthesis in Corynebacterium glutamicum and E. coli
Author List:
Larsen, Eric; Undergraduate, Biological Sciences, California State University, Stanislaus, Presenting Author
Kozlov, Kristina; Undergraduate, Biological Sciences, California State University, Stanislaus, Presenting Author
Antypas, Carla; Undergraduate, Biological Sciences, California State University, Stanislaus
Montalvo, Juan; Graduate, Biological Sciences, California State University, Stanislaus
Cordova, Paul; Undergraduate, Biological Sciences, California State University, Stanislaus
Dial, Rebekah ; Undergraduate, Biological Sciences, California State University, Stanislaus
Kim, Younghwa; Faculty, Biological Sciences, California State University, Stanislaus
Lee, Sung-Kwon ; Myongji University, South Korea, Biological Sciences, California State University, Stanislaus
Suh, Joo-Won ; Myongji University, South Korea
Kang, Choong-Min; Faculty, Biological Sciences, California State University, Stanislaus
Abstract: L-threonine is a limiting amino acid in livestock diets, and its deficiency results in not only malnutrition of the animals but also releasing increased volumes of nitrogen compounds to the environment. Addition of L-threonine into livestock feed is therefore important for healthier animals as well as a cleaner environment. Moreover, L-threonine is utilized in both pharmaceutical and cosmetic industries. Currently, L-threonine is produced by E. coli, which makes the purification of L-threonine difficult because it produces endotoxins. Thus, we seek to over-produce L-threonine by using Corynebacterium glutamicum, a GRAS (generally regarded as safe) microorganism. C. glutamicum produces L-threonine from aspartate through an enzymatic pathway involving aspartate kinase (LysC), aspartate semialdehyde dehydrogenase (Asd), homoserine dehydrogenase (Hom), homoserine kinase (ThrB), and threonine synthase (ThrC). Among these, LysC, Hom, and ThrB are feedback inhibited by the end-product, L-threonine. Releasing the feedback inhibition in LysC and Hom through mutating their allosteric site has successfully increased L-threonine biosynthesis. However, it has been unsuccessful to remove the feedback inhibition in ThrB because L-threonine inhibits the enzyme by competing with L-homoserine (substrate) for the same active site. To genetically separate the catalytic activity and the feedback inhibition in ThrB of C. glutamicum, we mutated an alanine residue (Ala20) at the gate of the active site into various amino acids such as hydrophobic residues (Leu and Val) and hydrophilic residue (Ser and Gly). Enzymatic kinetics with the wild-type and mutant forms of ThrB show that the ThrBA20G increased Ki for L-Threonine about 5-fold while it increased Km for homoserine only 2-fold. More importantly, when we introduced this mutation into C. glutamicum and E. coli, it increased approximately 20% of L-threonine production. Our approach can be applied to other metabolic enzymes that are similarly regulated by competitive feedback inhibition.
Poster #: 175
Project Title: Production of Hybrid Strains of Saccharomyces cerevisiae by Cell Fusion
Author List:
Dial, Rebekah ; Undergraduate, Biological Sciences, California State University, Stanislaus, Presenting Author
Wheeler, John; Staff, Biological Sciences, California State University, Stanislaus
Kang, Choong-Min; Faculty, Biological Sciences, California State University, Stanislaus
Abstract: Since the Neolithic age, brewer’s yeast (Saccharomyces cerevisiae) has widely been utilized for food and beverage production. Pure culture strains of S. cerevisiae have been utilized in brewing since the end of the nineteenth century, and recently the brewing industry has expanded dramatically. The implementation of genetically modified, hybrid S. cerevisiae strains into the brewing process has been hypothesized to improve several characteristics of the S. cerevisiae strains, introducing more desirable flavors as well as increased ethanol production and flavors. The short-term goal of this project is to develop hybrid S. cerevisiae strains by sporulation of various industrial S. cerevisiae strains such beer, wine, sake, and cider yeasts, identification and mating of a- and α-haploid types from each strain, and stabilization of hybrid strains. The long-term goal is to use these hybrid strains to commercialize noble sake, beer, or wine products.
Currently we have collected eleven industrial strains of S. cerevisiae including beer, sake and cider yeasts. Three strains have been induced sporulation by incubating in the SPO++ sporulation medium, in which the yeast cells are exposed to conditions of extreme starvation for nitrogen in the presence of a non-fermentable carbon source, such as acetate. After 7-day incubation period, sporulation efficiency was examined by light microscopy. Cells were treated with Zymolase to lyse the spore-containing ascus and incubated at 55 oC for 30 min to kill the vegetative cells. Then, the haploid cells were isolated by plating on YPD agar medium and their mating type was determined by individually mixing with each of two haploid “tester a or α strain” and testing their sporulation. We will continue to isolate haploid strains for the other industrial strains. Once the mating type of each haploid cell is determined, an a type from one strain will be fused with an α type from another strain. The hybrid strains will subsequently be stabilized by sub-culturing in YPD medium for months and utilized further in the brewing of alcoholic beverages, such as beer, wine, and sake.
Poster #: 176
Project Title: Blood Flow Simulation in Various Geometries of Human Carotid Artery Bifurcation
Author List:
Chang, Felix; Undergraduate, Mechanical Engineering, California State Polytechnic University, Pomona, Presenting Author
Rodriguez, Miguel; Undergraduate, Mechanical Engineering, California State Polytechnic University, Pomona, Presenting Author
Seong, Jaehoon ; Faculty, Mechanical Engineering, California State Polytechnic University, Pomona
Abstract: Pulsatile blood flow was simulated in three different carotid bifurcation models to understand local hemodynamic variations by the geometric differences using computational fluid dynamics (CFD) tool, COMSOL. The carotid artery bifurcation consists of the common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA) with sinus. The geometry of the carotid artery bifurcation plays a critical role in the development of atherosclerosis. An analysis of local hemodynamics with geometric considerations in the bifurcation might help to understand the underlying cause of the vascular disease. The objective of this project was to analyze flow behavior in the carotid artery bifurcation of three healthy models. The 3-D model geometry was created in SolidWorks and then imported to COMSOL. Tetrahedral mesh structure of the carotid bifurcation was constructed with the element dimensions in between a minimum of 0.214 mm and maximum of 0.716 mm. The simulation was conducted using a time dependent single phase laminar flow based on Navier-Stokes equation. The density and dynamic viscosity of working fluid were 1060 kg/m3 and 3.2×10-3 Paˑs, which are the matching values of blood properties. Inlet pressure at CCA and outlet flow rates at ECA and ICA were applied for the boundary conditions in this study. Through the computational simulations, velocity profiles and volume flow rates in all three models were analyzed. The average velocity at CCA during a cardiac cycle in all models showed a similar magnitude of maximum of 0.27 m/s at peak systole and minimum of 0.12 m/s during diastole. The pressure measurements during a cardiac cycle showed no significant difference in all models. However, the flow separation ratios between ECA and ICA were showed a remarkable difference. Model#1 showed about 80% of blood went through the ICA. But, Model#2 and #3 showed approximately 70% and 65% of blood flowing through the ICA. It seems that the geometric difference with associated pressure gradients might cause the flow rate changes in two daughter branches. This study was a preliminary investigation with few models of human carotid bifurcation with related flow conditions. Extensive study of blood flow simulation in more carotid geometry might help to provide a better understanding of the underlying cause of vascular diseases at the carotid bifurcation.
Poster #: 177
Project Title: Biologically Inspired Damage Tolerant Materials
Author List:
Thenuwara, Ryu; Undergraduate, Biomedical, Chemical & Materials Engineering, San José State University, Presenting Author
Treffkorn, Lucas; Graduate, Biomedical, Chemical & Materials Engineering, San José State University, Presenting Author
Diaz, Steve; Graduate, Biomedical, Chemical & Materials Engineering, San José State University
Abstract: The objective of this project is to develop a damage tolerant material inspired by abalone and other mollusks nacre, test its properties, and study its failure mode. Nacre consists of brittle ceramic (aragonite) tiles with asperities, with ductile organic layers in between the ceramic tiles acting as adhesives, biding the tiles together. The overall arrangement of the nacre is close to a brick and mortar structure. The said structure is believed to have improved overall mechanical properties compared to its monolithic counterpart, resists fracture propagation, and thus prevents catastrophic failure of the overall structure.
In the first phase of this project the mechanical properties displayed by nacre was successfully replicated using silicon carbide and alumina tiles, both ceramic materials, with an organic adhesive binding them. Three point flexural testing, drop weight flexural testing and drop weight compression testing was conducted. Two nacre-inspired structures and a monolithic counterpart were tested. It was found that by imitating the nacre structure the fracture toughness improved ten times, as compared to the monolithic counterpart. The energy absorbed before failure during three point flexure testing was 15.4 J and 1.5 J for the nacre structure and monolithic structure, respectively. While the nacre structures did sustain damage, catastrophic failures did not occur; the monolithic counterparts failed catastrophically.
The second phase is focused on building structures that are closer to abalone nacre in dimension in order to better replicate the bio-inspired structure on an engineering basis. Structures consisting of thermoset polymer tiles with asperities (brittle) with a thermoplastic adhesive binding them will be constructed and tested in the same manner as previously. The ceramic (aragonite) tiles are being replaced with a thermoset polymer to improve the fabrication capability in the laboratory.
Poster #: 178
Project Title: Biofeedback device for evaluation and correction of gait asymmetry
Author List:
Rojas, Omar; Undergraduate, Electrical Engineering, California State University, Long Beach, Presenting Author
Balagtas, Michael ; Undergraduate, Electrical Engineering, California State University, Long Beach, Presenting Author
Bocanegra, Gerardo; Undergraduate, Electrical Engineering, California State University, Long Beach
Khoo, I-Hung; Faculty, Electrical Engineering, California State University, Long Beach
Marayong, Panadda; Faculty, Mechanical & Aerospace Engineering, California State University, Long Beach
Krishnan, Vennila; Faculty, Physical Therapy, California State University, Long Beach
Abstract: We developed a portable device, named ‘Walk-Even’, that can measure and analyze gait asymmetry. Our device collects data in real time on a patient with the purpose of evaluating and improving the patient’s asymmetrical gait. Gait asymmetry is usually exhibited in patients with stroke or certain neurological disorders. Our device can measure the weight pressure distribution that the patient exerts on each foot, the time it takes for the patient to complete a gait cycle, and the swing times of each leg while walking. Based on the real time information, a biofeedback will be given by means of visual, auditory, and unpleasant sensory stimulation to correct any anomaly in the patient’s gait and foot weight distribution.
The ‘Walk-Even’ device works by taking readings from our specially designed sensor embedded in-soles that interface with a microcontroller where the raw data is analyzed and then sent wirelessly to a Windows based computer running our software. The microcontroller, an Arduino Mega 2560, is housed inside a compact enclosure that is attached to the patient’s waist. The wireless capability is achieved by two XBee modules – one connected to the microcontroller and the other to the computer. The insoles consist of a front and a back piece, which can be adjusted to fit any shoe size, and contain force sensitive resistors (FSR), which can detect pressure. The pressure readings from the FSR are analyzed by the microcontroller using our pre-programmed algorithms, and the results are sent back to the software to be displayed to the user. The programs within the microcontroller also dictate when to give the biofeedback to the patient, such as when the swing time of one leg is longer than the other. The low cost, user-friendly software, and portability of our device make it ideal for helping patients with asymmetrical gait to improve their gait. Due to its simplicity, our device can also be used in a non-clinical setting. To confirm the reliability and validity of our device, we compare our measurements with the commercial devices MobilityLab and TekScan. TekScan is used to validate the asymmetry pressure data while MobilityLab is used to validate the gait cycles.
Poster #: 179
Project Title: Methods for Rapid Extraction of High-Quality RNA from FFPE Cancer Tissue
Author List:
Hoover, Malachia; Graduate, Biology, California State University, Northridge, Presenting Author
Brown, Mark; Claremont BioSolutions
Maawy, Ali; UC San Diego
Hoffman, Robert; AntiCancer Inc.
Bouvet, Michael; UC San Diego
Doebler, Robert; Claremont BioSolutions
Kelber, Jonathan; Faculty, Biology, California State University, Northridge
Abstract: Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of cancer-related deaths. Because there are virtually no biomarkers to aid in early detection or predicting therapy response, newly diagnosed patients have a dismal prognosis. Substantial archives of formalin-fixed, paraffin-embedded (FFPE) samples from PDAC tissue have been established and linked to clinical data. However, identifying biomarkers from these tumors is severely hindered because extracting high-quality nucleic acid material from FFPE samples is time-consuming and inefficient. Thus, developing improved methods for extracting high-quality RNA/DNA from FFPE samples represents an unmet need in the fields of cancer biology and Next-Generation Sequencing (NGS). We have tested Claremont BioSolutions’ microhomogenization (mH) tools in combination with commercial FFPE RNA extraction kits for their ability to improve high-quality RNA recovery from PDAC xenograft samples. Our results demonstrate that the addition of brief (< 5min) mH steps improves total RNA yield up to 3-fold over current methods, as well as RNA purity and length, as characterized by 260/280 ratios (2.03 +/- 0.02 w/ mH step) and chip-based electrophoresis (RNA Quality Index = 7.3 w/ mH step for formalin-fixed samples prior to paraffin embedding). These results have important implications for streamlining the FFPE-RNA-NGS workflow as a realistic approach for cancer biomarker identification.
Poster #: 180
Project Title: Automatic Detection and Identification of Pediatric Heart Sounds Using Wavelet Analysis and a Dynamic Bayesian Network
Author List:
Sedighian, Pouye; Staff, Computer Engineering and Computer Science, California State University, Long Beach
Erfanian, Bahar; Graduate, Computer Engineering and Computer Science, California State University, Long Beach, Presenting Author
Asgari, Shadnaz; Faculty, Computer Engineering and Computer Science, California State University, Long Beach
Abstract: Cardiovascular disease remains the leading cause of death worldwide. Early detection of cardiovascular diseases may enhance the efficacy of the related treatments or interventions. Cardiac auscultation, listening to the heart sounds generated by rhythmic contractions of the heart using a stethoscope, is currently the primary means of cardiac examination at basic health care clinics. Heart sounds provide valuable information about the cardiovascular system and functionality of heart valves. Accurate manual auscultation (heart sound interpretation) requires extensive training and experience. Hence, the reliability of diagnosis is dependent on the level of training or experience of the clinician. Automatic auscultation can address this issue by allowing for an in-depth analysis of heart sounds and identification of abnormal patterns such as murmurs. The first step in automatic cardiac auscultation is heart sound segmentation by identifying two prominent audible components of heart sounds (S1 and S2) in each heart cycle of a phonocardiogram. Pediatric heart sound segmentation is specifically a challenging task due to various confounding factors including the significant influence of respiration on children’s heart sounds.
The current work aims at development of a novel method for automatic pediatric heart sound segmentation. Following pre-processing of the phonocardiogram, a Wavelet transform was employed to alleviate the effect of confounding factors on pediatric heart sounds. Then the Shannon energy envelogram of the signal was extracted and its peaks were identified. Few physiological inspired criteria were applied to determine a subset of detected envelogram peaks which corresponds to the true S1 and S2 peaks. Finally, a one dimensional and two-state unsupervised Hidden Markov Model (HMM) was applied to identify the peaks as either S1 or S2. The performance of the proposed method was evaluated on a publicly available dataset using a 20-fold cross validation. The dataset included 84 records of phonocardiograms of pediatric patients with corresponding S1 and S2 annotations. The results showed that our proposed method achieves the high accuracy of 92.6% ±1.2% and 91.8% ±1.2% in identification of first and second heart sound components, respectively, and therefore it can be reliably employed for automatic heart sound segmentation of pediatric auscultation.
Acknowledgement: The presented work was supported by a CSUPERB New Investigator Grant awarded to S.A.
Poster #: 181
Project Title: Assessment of the Contribution of Dispersion Interactions in the Energetics of Bergman Cyclization of Enediynes
Author List:
Nguyen, Anthony; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Gheman, Benjamin; Faculty, Chemistry, California State University, Sacramento
Spence, John; Faculty, Chemistry, California State University, Sacramento
Abstract: Enediyne compounds are of interest due to their potential in anticancer chemotherapy. Upon exposure to heat or light, enediynes undergo C1-C6 Bergman cyclization, in the process forming a diradical. These diradicals are able to excise hydrogen atoms from the sugar backbone in DNA, thereby disrupting the double helix and leading to cell death. The favorability of photo-Bergman cyclization can be enhanced by adding substituents onto the terminal alkyne groups. While both phenyl and naphthyl substituents would provide extended conjugation to the enediyne, it was hypothesized the smaller steric bulk of the phenyl groups would lead to lower activation and reaction energies for cyclization compared to the naphthyl groups. Previous computations, though, using density functional theory (DFT) led to contradictory results, with the phenyl-substituted enediynes actually having slightly higher activation and reaction energies for Bergman cyclization. Dispersion interactions between the aromatic substituent groups, not previously accounted for, are investigated here in order to more accurately model Bergman cyclization. Indirect methods of accounting for dispersion, such as double-hybrid DFT and long-range corrected DFT, are used to calculate reaction energetics along with explicit dispersion energy corrections to DFT. Data indicate that activation and reaction free energies are lower when dispersion energies are added to the standard and double-hybrid DFT methods, with the effect being generally proportional to the size of the alkyne substituent groups. On the other hand, results with long-range corrected DFT appear irregular, and suggest this method is not well suited to this type of cyclization reaction. The results also demonstrate that inclusion of dispersion energy in DFT calculations can explain the differences in energetics for cyclization of enediynes with phenyl and naphthyl substituents.
Acknowledgements: Funding for this project has been provided by California State University, Sacramento to B.F.G. through the College of Natural Sciences and Mathematics and through a Research and Creative Activity Grant.
Poster #: 182
Project Title: Mechanism and Prospect for Stereoselectivity in Metal-Salen Catalyzed Electroreductive Cyclization Reactions
Author List:
Cihak, Michelle; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Silva, Braden; Undergraduate, Chemistry, California State University, Sacramento
Gherman, Benjamin; Faculty, Chemistry, California State University, Sacramento
Miranda, James; Faculty, Chemistry, California State University, Sacramento
Abstract: Electroreductive cyclization (ERC) occurs when an electron deficient alkene is electrochemically reduced, and thus able to react with another electron deficient alkene. This type of reaction in which two electrophiles are brought to react together is difficult to achieve without the use of electrochemistry. ERC is a key step in the total synthesis of complex natural products with pharmaceutical applications, such as the Corey lactone derivative (a prostaglandin precursor) and quadrone (an anticancer compound). Reduced metal-salens can be used to mediate electron transfer to the ERC substrate. Previous theoretical work has determined that an inner-sphere electron transfer is favorable for Ni(II)-salen and Zn(II)-salen. For this computational study, the mechanism and stereoselectivity of substrate cyclization following this electron transfer will be studied for both chiral and achiral Ni(II)-salen and Zn(II)-salen. For each metal-salen, two pathways will be examined for the cyclization of two ERC substrates, an α, β-unsaturated ester and aldehyde. The first is a concerted pathway, where cyclization and separation of the substrate from the metal-salen occur at the same time. This pathway is critical for obtaining stereoselectivity during the reaction and maximizing the utility of ERC in organic synthesis. The second is a stepwise pathway, where the substrate detaches from the metal-salen yielding an intermediate radical carbanion, which proceeds to subsequently cyclize. Using density functional theory (DFT) calculations, energetics for the ERC reactions are computed, and the kinetically preferred pathway for each salen/substrate combination is determined. Results from the achiral Ni(II)- and Zn(II)-salens show the stepwise mechanism to be energetically preferred over the concerted mechanism; thus, minimal to no stereoselectivity is predicted with the achiral metal-salens. Further data indicates that introduction of chirality into the metal-salen electrocatalyst can in fact alter the stereoselectivity of the cyclized product.
Acknowledgements: Funding for this project has been provided by: (a) California State University, Sacramento to B.F.G. through the College of Natural Sciences and Mathematics and a University Enterprises, Inc. Faculty Grant, to M.C. through a Russell-Forkey Research Award, and to B.E.S. and J.A.M. through an IRA program grant; and (b) a NSF MRI program grant (#0922676) to J.A.M.
Poster #: 183
Project Title: A Heterogeneous Compute Solution for Optimized Genomic Selection Analysis
Author List:
DeVore, Trevor; Graduate, Computer Science, California Polytechnic State University, San Luis Obispo
Winkleblack, Scott; Graduate, Computer Science, California Polytechnic State University, San Luis Obispo
Golden, Bruce; Faculty, Dairy Science, California Polytechnic State University, San Luis Obispo
Lupo, Chris; Faculty, Computer Science, California Polytechnic State University, San Luis Obispo, Presenting Author
Abstract: This research presents a heterogeneous computing solution for an optimized genetic selection analysis tool, GenSel. GenSel can be used to efficiently infer the effects of genetic markers on a desired trait or to determine the genomic estimated breeding values (GEBV) of genotyped individuals. To predict which genetic markers are informational, GenSel performs Bayesian inference using Gibbs sampling, a Markov
Chain Monte Carlo (MCMC) algorithm. Parallelizing this algorithm proves to be a technically challenging problem because there exists a loop carried dependence between each iteration of the Markov chain. The approach presented in this
research exploits both task-level parallelism (TLP) and data-level parallelism (DLP) that exists within each iteration of the Markov chain. More specifically, a combination of CPU threads using OpenMP and GPU threads using NVIDIA’s CUDA paradigm is implemented to speed up the sampling of each genetic marker used in creating the model. Performance speedup will allow this algorithm to accommodate the expected increase in observations on animals and genetic markers per observation. The current implementation executes 1.84 times faster than the optimized CPU implementation. This research is supported by the USDA National Institute of Food and Agriculture, AFRI competitive grants program project 0227921.
Poster #: 184
Project Title: Exploring the Unseen World of Fungal Biodiversity: A Hybrid-Gene Approach to Creating Phylogenetic Trees
Author List:
Fouquier, Jennifer; Graduate, Bioinformatics, San Diego State University, Presenting Author
Kelley, Scott T.; Faculty, Biology, San Diego State University
Abstract: Molecular biology methods, combined with NGS technologies and bioinformatics, have revolutionized our understanding of microbial diversity. NGS studies have allowed researchers to investigate microbial diversity associated with human health and disease, connect microbial community dynamics to ecosystem function, and discover new life in diverse habitats. While these methods have been extensively developed for studying bacteria, technical issues have hampered our ability to comprehensively describe fungal diversity. Fungi play significant roles in many ecosystems, are implicated in many human diseases, and can be a major issue in the homes and buildings. The 16S small-subunit (SSU) ribosomal RNA (rRNA) gene marker has been the gold standard for describing bacterial diversity. However, the analogous 18S SSU rRNA in fungi has not been effective for studying fungal biodiversity because of its high conservation rate among fungal species. Recently, researchers have developed a set of PCR primers that amplify the Internal Transcribed Spacer (ITS) region across many fungal groups. While the high variability among fungal ITS sequences allows for finer species resolution, the lack of evolutionary constraints means that, unlike the rRNA sequences, it is difficult to align ITS sequences or make accurate phylogenetic trees across distant phyla. Phylogenetic trees are required for many microbial analysis tools, such as UniFrac, QIIME and SourceTracker. Here, we describe the creation of a bioinformatics method that creates a hybrid 18S + ITS-1 phylogenetic tree for use with these tools. We tested this method using two different ITS-1 fungal sequence datasets, one from indoor environments and one from human saliva. The hybrid phylogenetic tree had 50% shorter branch lengths than a tree based solely on ITS-1 sequences, indicating more accurate multiple sequence alignments. Comparisons of UniFrac to non-phylogenetic methods showed them to be highly correlated (Bray-Curtis: r = 0.82, p = 0.001; Binary-Jaccard: r = 0.57, p = 0.001). However, UniFrac provided more information than the other metrics, such as spatially realistic principal coordinate plots and community shifts between weighted and unweighted analyses. The additional data provided by the hybrid tree approach is a significant improvement to culture-independent analyses of fungal biodiversity.
Funding provided by the Alfred P. Sloan Foundation.
Poster #: 185
Project Title: Development of Mobile Bioinformatics Training Apps for Biotechnology
Author List:
Didulo, Dennis; Graduate, Bioinformatics, San Diego State University, Presenting Author
Kelley, Scott; Faculty, Biology, San Diego State University
Abstract: Computational (Bioinformatics) analytical tools have become increasingly critical for Biotechnology. Algorithms for sequence alignment, genome assembly, protein and RNA structure prediction, motif searching, phylogenetic tree building and many others have available for years. However, the exponential increase in biological data generated by rapidly evolving Next-Generation Sequencing (NGS) and other high-throughput technologies, has dramatically increased the importance of Bioinformatics in molecular biology research. This, in turn, has lead to a significant growth in the need for high-quality Bioinformatics educational resources to train both computer scientists and molecular biologists.
Here, we describe and demonstrate a completed prototype of our online interactive Bioinformatics educational modules for mobile devices. The finished modules include a series of apps teaching fundamental Bioinformatics topics (e.g., sequence alignment). Each app explains the biological background behind the approach, teaches the basis of the software algorithms, and demonstrates via examples and tutorials how to use current analysis tools. Completed features include: (1) Interactive, touch screen problem sets that provide instant feedback and limitless computer generated practice problems; (2) Direct links to data analysis websites with real test data and step-through tutorials that can be updated rapidly when websites change or links break; and (3) Biological background in blog-format that includes animations, images, links, and voice-over lectures.
The completed apps have already been successfully deployed and tested in the PIs Bioinformatics course at San Diego State University and are available for use at www.kelleybioinfo.org. Current and future versions of this CSUPERB funded software will be made available to all CSU campuses free of charge. Future versions will include new modules for advanced topics covering the needs of modern Biotechnology (e.g., genome assembly). We will also develop a series of simplified modules for Middle and High School education focusing on DNA sequence matching.
Poster #: 186
Project Title: Comparative Study of Pulse Onset Detection Methods for Cerebral Blood Flow Velocity
Author List:
Tran, Tan; Undergraduate, Computer Engineering and Computer Science, California State University, Long Beach, Presenting Author
Scalzo, Fabien ; Department of Neurology, University of California, Los Angeles
Hamilton, Robert ; Neural Analytics, Inc., Los Angeles
Hanchey, Dan; Neural Analytics, Inc., Los Angeles
Asgari, Shadnaz; Faculty, Computer Engineering and Computer Science, California State University, Long Beach
Abstract: Intracranial pressure (ICP) measurement is crucial in diagnosis and management of various neurological disorders, e.g. traumatic brain injury. In intensive care units of modern hospitals, ICP is currently measured invasively through the surgical penetration of the skull. Since ICP measurement carries several major risks including intracerebral hemorrhage and infection, development of a non-invasive method for such measurement would be substantially valuable.
Recent studies have shown that waveform morphology of cerebral blood flow velocity (CBFV), measured non-invasively at major cerebral basilar arteries by using a transcranial Doppler (TCD) ultrasound, holds predictive information about the ICP level. An essential step in extracting and analyzing CBFV morphology is the reliable identification of its pulse onset (foot of the pulse). CBFV pulse onset detection is a challenging task because the high level of noise which are prevalent in TCD recordings purturbates pulse morphologies and causes major signal baseline instability. The current work is aimed at development of an automatic and robust CBFV pulse onset detection method.
For this purpose, we conducted a comparative study of four existing algorithms originally developed for onset detection of pulsatile signals other than CBFV. These methods employ various sophisticated filtering techniques for signal conditioning and then use adaptive thresholding for pulse onset detection. Here, we re-implemented them for CBFV pulse onset detection and compared their performance in terms of algorithm’s sensitivity, positive predictive value, time complexity, and robustness to the noise. Our dataset consisted of 12 recording of CBFV signals (total of 4186 pulses) and electrocardiogram signals collected from 7 subjects who were admitted at UCLA Medical Center for subarachnoid hemorrhage evaluation. CBFV was measured at middle cerebral artery with sampling frequency of 400 Hz. The aforementioned four algorithms were applied to the collected CBFV signals and the accuracy of each method was evaluated by comparing the detected pulse onsets with those annotated by an expert using electrocardiograms as a reference signal. Our results showed that the most robust method achieves the sensitivity of 92.86%, positive predictive value of 99.9% and has a running time of 1 ms/pulse. Hence, this method could be reliably used for automatic CBFV pulse onset detection in real-time, and consequently for non-invasive ICP estimation.
Poster #: 187
Project Title: Salivary Bacterial Biomarkers for the Early Detection of Pancreatic Cancer
Author List:
Torres, Pedro; Graduate, Biology, San Diego State University, Presenting Author
Fletcher, Erin; Undergraduate, Biology, San Diego State University
Bouvet, Michael; University of California, San Diego
Doran, Kelly; Faculty, Biology, San Diego State University
Kelley, Scott; Faculty, Biology, San Diego State University
Abstract: In the United States, approximately 40,000 people die every year from pancreatic adenocarcinoma, making it the fourth leading cause of cancer related deaths. Patients diagnosed in the early stages of pancreatic cancer have a 5-year survival rate of 21.5%. Early stage pancreatic cancer patients tend to be asymptomatic and half of the cancers are detected only after they have metastasized, emphasizing the need for early detection biomarkers. Recent research suggests that oral microbiota may be indicative of pancreatic disease; however, whether specific oral bacterial species are reliable indicators of disease is not known. Here, we characterized the salivary microbiota of patients with pancreatic cancer and compared them to other digestive and non-digestive cancers and disease states (e.g. pancreatitis, pancreatic cyst) as well as non-diseased controls. We enrolled a total of 136 patients (64 female and 72 males, with an average age of 59.7 years) at the UCSD Medical Center and collected saliva, buccal swabs, patient demographic data including ethnicity, oral hygiene and tobacco use. Of the 136 patients, 9 have been diagnosed with pancreatic cancer, 8 with pancreatic disease, 75 with digestive disease (including cancer), 22 with a non-digestive disease (including non-digestive cancer) and 22 were non-disease (healthy) controls. Salivary microbial diversity profiles were analyzed using culture-independent methods based on direct amplification and high-throughput sequencing of bacterial 16S ribosomal RNA gene sequences. The QIIME 16S analysis pipeline was used to determine the types and abundance of bacteria in saliva. After normalizing for a sequence depth of 2,800 sequences for all samples we found significant differences in the absolute abundance ratio of particular bacterial genera between pancreatic cancer and non-digestive disease patients. Specifically, the ratio of Leptotrichia goodfellowi and Leptotrichia hongkongenesis to Porphyromonas was higher in pancreatic cancer patients. We also found a high significant difference in the same bacterial abundance ratio between pancreatic cancer and other digestive disease and pancreatic disease, as well as non-diseased controls. Our results suggest that culture independent analysis of salivary bacteria is promising as an early biomarker for detection of pancreatic cancer.
Poster #: 188
Project Title: Photophysical Characterization of Free-Base Corrole for Photodynamic Therapies and Drug Delivery
Author List:
Loogman, Anthony; Undergraduate, Chemistry, California State University, Stanislaus, Presenting Author
Becerra, Stephanie; Undergraduate, Chemistry, California State University, Stanislaus
Calvillo, Guadalupe; Undergraduate, Chemistry, California State University, Stanislaus, Presenting Author
Klein, Silvia; Undergraduate, Chemistry, California State University, Stanislaus
Trejo, Monica; Undergraduate, Chemistry, California State University, Stanislaus
Alemán, Elvin; Faculty, Chemistry, California State University, Stanislaus
Abstract: Corroles, which are tetrapyrrolic ring structures, have become a focus in research including the diagnosis and treatment of cancer. They have a structure similar to that of porphyrins, which are currently being researched in blocking tumor progression and metastasis. Corroles contain similar photophysical properties to those of porphyrins. However, unlike free-base porphyrin, free-base corrole shows significant differences in photophysical properties when dissolved in nonpolar and polar solvents. These differences correspond to the formation of two tautomers of free-base corrole with a different arrangement of the conjugated pi system in the macrocycle. In order to use corrole in photodynamic therapies or in a photosensitizer drug delivery system, we need to fully understand which property of the solvent determines the formation of a specific tautomer. New methods of synthesizing corroles provide better yields to further the research of its chemical and photophysical properties and uses in cancer treatment.
In order to obtain a greater yield of corrole, and to extend the study of its photophysical properties, we synthesized (one-pot synthesis) and purified free-base triphenylcyanocorrole (CN-Corrole). We have characterized CN-Corrole using 1H-NMR and mass spectroscopy. The UV-visible and fluorescence spectra of CN-Corrole show similar tautomeric effects to those observed for unsubstituted corrole, which demonstrated that CN-Corrole is a good model to study solvent effect in the structure and photophysical properties of free-base corrole. However, when we dissolved CN-Corrole in several solvents, the UV-visible spectra show that both tautomers co-exist in solution. Because the emissive properties of corroles can be used in the development of tumor markers, we have also investigated how these solvents induce changes to the fluorescence properties of corroles. In order to investigate the photophysical properties of the reduced and oxidized corrole species, we are also investigating the spectroelectrochemical properties of corrole tautomers.
The objective of this project is to characterize the photophysical properties of CN-Corrole, and find how the solvent controls the tautomerization transition. The long-term goal of this work is to determine how solvent molecules can influence the ability of free-base corrole to capture and emit light and identify potential applications of the different tautomeric forms in cancer diagnosis and treatment.
Poster #: 189
Project Title: Stability study of DNA-Gadolinium (III) complex by reverse phase high performance liquid chromatography
Author List:
Galvan, Stephan; Graduate, Chemistry and Biochemistry, California State University, East Bay, Presenting Author
Abstract: Magnetic Resonance Imaging, or MRI, is one of the most commonly used clinical imaging techniques. Often times when conducting an MRI, a Gd(III)-based contrast agent is administered to improve the quality of the image obtained. To reduce toxicity and increase ease of clearance from the body, the Gd(III) ion (which can interfere with biological processes) is administered as a complex bound to an organic ligand. Unfortunately, the Gd(III) ion can become dissociated from the complex and cause fatal side effects in patients, especially those with kidney dysfunction. While all Gd(III) contrast agents today rely on the use of organic compounds, this study investigates the use of a single stranded DNA molecule, aptamer, as the ligand for the Gd(III) ion. An advantage of aptamers is the ability of the molecule to bind with high specificity and affinity to the target of interest.
To investigate the potential of a DNA aptamer to replace the organic molecule ligand, we decided to study and quantify the stability of the DNA-Gd(III) complex under various conditions (buffer ionic strength, pH and in the presence of competing metal ions) by reverse-phase HPLC. We decided to take advantage of Gd(III) fluorescent properties and aimed our initial study at direct detection of Gd(III) ion in both the aptamer-bound and dissociated free ion form. To induce complexation, GdCl3 was incubated with aptamer (commercially obtained 43-nucleotide long DNA aptamer) in HEPES buffer at pH 7.4. Following HPLC method development (with different buffer compositions, organic solvent mobile phase and pH), the desirable concentration of Gd(III) was discovered to be below the limit of our fluorescent detector. While measuring the Gd(III) directly would be ideal, due to the extremely low molar extinction coefficient of Gd(III) ion, fluorescence detection was not feasible. We subsequently decided to monitor the bound and unbound aptamer instead via diode array detector (DAD). Presently, we are in the method development stage using DAD and once successful, we will proceed to quantify the stability of the Gd(III)-aptamer complex under different conditions. To this end, we have discovered the optimal mobile phase composition to be triethylammonium acetate buffer (100 mM) at pH 7.4 and acetonitrile (11%) for the unbound aptamer and that the composition of the complex is 3:1 molar ratio of Gd(III) ion to aptamer.
Poster #: 190
Project Title: Unique copper-related characteristics of canine vs human and rodent blood plasma that may be related to copper toxicosis in this species
Author List:
Flynn, Stephen; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Tellez, Miguel; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Guardado, Jose; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Weldy, Scott; Serrano Animal and Bird Hospital, Lake Forest
Fieten, Hille; University of Utrecht, The Netherlands
Linder, Maria C.; Faculty, Chemistry and Biochemistry, California State University, Fullerton
Abstract: In humans and most other mammals that have been examined, tissue concentrations of Cu are relatively constant. The liver particularly adjusts to the amounts of Cu that enter from the diet, excreting less or more into the bile (the main excretory route) to maintain homeostasis. It has long been known that as a species, dogs are peculiar in having a form of albumin in their blood plasma that does not bind Cu tightly, and in having >10-fold higher concentrations of Cu in their livers, which often leads to Cu toxicosis and death. The latter condition has been attributed mainly to a decreased ability to transfer Cu into bile. The same problem occurs in Wilson disease (and animal models) in which the gene for the Cu pump, ATP7B, is defective.
To determine whether changes in blood plasma Cu binding components might reflect the Cu status of dogs, indicating whether they had excessive liver accumulation and/or inflammation predisposing to toxicosis, we analyzed samples of heparinized dog plasma from Labrador retrievers with high and low liver Cu, with/without hepatitis and/or the presence of a gene mutation that might be responsible for liver Cu accumulation. Samples were analyzed for total Cu by furnace AA, and ferroxidase and p-phenylene diamine oxidase activities (functions of ceruloplasmin); Cu containing components were separated in size exclusion FPLC (SEC) on Superdex 200.
Total plasma Cp and ceruloplasmin oxidase activities of dogs were in general considerably lower than those in humans and rats, and because of considerable variability between dogs, there were no significant differences attributable to high vs low liver Cu, inflammation, or the presence of the mutated gene in question. However, the Cu profiles obtained by SEC were very different from those in humans and rodents. Most of the Cu was associated with unknown proteins considerably larger than ceruloplasmin (normally the component with the most Cu); ceruloplasmin protein eluted much earlier than expected, suggesting it might be in apo form; and some dogs ~50% of total plasma Cu associated with a small Cu component (SCC) that was also found in the plasma of Wilson disease mice (Atp7b-/-).
We conclude that dogs may differ markedly not only in terms of their albumin and tendency towards toxicosis but in their individual abilities to mobilize a form of Cu (SCC) that can be excreted in the urine after filtration by the kidney glomerulus, as also occurs in Atp7b-/- mice.
Poster #: 191
Project Title: Multiplex qPCR for simultaneous detection of Listeria monocytogenes and Bacillus cereus
Author List:
Chavan, Yesheswi; Graduate, Biology, California State University, Fresno, Presenting Author
Calderon-Urrea, Alejandro; Faculty, Biology, California State University, Fresno
Abstract: Around 9.4 million episodes of food borne illness are estimated in United States each year. Escherichia coli, Salmonella typhimurium, Listeria mocytogenes, and Bacillus cereus are some of the leading bacterial pathogens found in various food sources and remain a major health concern worldwide. With a Multiplex qPCR technique one can simultaneously detect two or more DNA specific sequences of pathogens in the same reaction mixture; in fact our lab developed a Multiplex qPCR protocol to simultaneously detect the Gram-negative bacteria Escherichia coli and Salmonella typhimurium. The objective of this project is to standardize a protocol for Multiplex qPCR to detect the Gram-positive bacteria Listeria mocytogenes and Bacillus cereus and evaluate the sensitivity of this approach.
Two set of primers each specific to Listeria mocytogenes and Bacillus cereus were designed using the Vector NTI software. The annealing temperature required for these two primer were optimized. TaqMan® probes for both the species were designed using the Real time design™ software offered by Biosearch Technologies ensuring that the probes lie between the forward and reverse primers of each primer sets. The Mastercycler® ep Realplex2 enables detection at 520nm and540nm. Based on the emission spectra of the dyes, FAM and Cal Fluor Gold 540 were used for the detection of Listeria mocytogenes and Bacillus cereus respectively. Multiple assays were run to check for the success of the TaqMan assay. A standardized protocol was designed with optimum PCR conditions to enable simultaneous amplification, real time and high throughput detection. Sensitivity and limit of detection of multiplex qPCR were analyzed for various food sources based on the colony count (CFU) on each serially diluted sample. DNA extraction of each food sample with their dilutions were carried out followed by multiple qPCR TaqMan assays. The lowest range of amplification that is obtained is correlated to estimate the lowest limit of detection in CFUs. This standardized protocol is designed to help the current need of simultaneous detection of two pathogens in Food Industry. The assay process time is six-eight hours in contrast to ~72 hour culture plating method. Hence this technique is not only less labor intense but also highly cost effective.
Poster #: 192
Project Title: The sodium channel blocker tricaine reduces regeneration in Lumbriculus variegatus : a study at the ultrastructural and light microscopic levels
Author List:
Alkhathlan , Manal ; Graduate, Biological Sciences, Humboldt State University, Presenting Author
O’Gara, Bruce A.; Faculty, Biological Sciences, Humboldt State University
Abstract: The California Blackworm (Lumbriculus variegatus) has great ability to regenerate from small fragments into a new worm. Regeneration of the head segments following amputation produces 7-8 new segments while the number of tail segments regenerated is dependent on the time following amputation. Several studies show that increasing internal sodium levels via voltage gated sodium channels is important in the early stages of regeneration. In this study, we exposed worms to the voltage-gated sodium channel blocker tricaine (MS-222) and examined somatic regeneration of heads and tails following body transection. Images of regenerating worms under normal conditions and worms treated with 1700 µM tricaine were examined for 5-10 days after amputation through TEM, SEM, and light level microscopy. Regeneration of both new head and tail body segments was reduced in the presence of tricaine, with tail regeneration being more severely effected. Examination of regenerating tissue at the TEM level in tricaine-treated worms showed the presence of lamellar bodies, probably indicating a drug-induced phospholipidosis. We will examine if cellular proliferation is affected by tricaine by using Edu incorporation into DNA. From these results we conclude that blockade of voltage-gated sodium channels reduces regeneration of heads and tails in blackworms.
Poster #: 193
Project Title: Synergistic activity of antimicrobial peptides and lipids – important for host defense and possibly a platform for new drugs
Author List:
Parducho, Kevin R.; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author, Nagel Award Finalist
Porter, Edith; , Biological Sciences, California State University, Los Angeles
Abstract: Microbial multi-drug resistance is a rapidly growing concern in the health sector and a challenge for pharmaceutical companies. A specific factor for the robust defense of some of these microbes is their ability to form biofilms. Research shows that antimicrobial peptides (AMPs), derived from human immune cells, have the ability to inhibit the formation of biofilms. Host-derived antimicrobial lipids have recently emerged as additional important defense factors and preliminary data from our laboratory suggest that cholesteryl arachidonate formulated in phospholipid liposomes (CA-PL) and phospholipid liposomes alone (PL) inhibit biofilm formation by Pseudomonas aeruginosa, a major cause of health care associated infections. We hypothesized that the AMPs: human beta defensin 2 (HBD2), human neutrophil peptide 1 (HNP1), and the human cathelicidin LL-37, may act in synergism with CA-PL and PL. Bacteria were incubated in microtiter plates for 18 h with and without the antimicrobial agents and biofilm was quantified by crystal violet staining. HBD2 (10 µM) reduced biofilm formation by 55.42%, CA-PL (31.25 µg/mL -250 µg/mL) by 31.58%, and PL (250 µg/mL) by 34.55%. However, when applied together, HBD2 + CA-PL reduced biofilm by 97.26% while HBD2 + PL reduced biofilm by 63.51%, suggesting synergistic activity between HBD2 and CA-PL. This was accompanied by aggregation of the planktonic, not biofilm-associated bacteria as observed by microscopy, and a 1.2 – 2.5 fold amplification of CFU reduction when bacteria were incubated with CA-PL and either HBD2 or HNP1 compared to each agent alone. AMP concentrations that inhibited 50% of biofilm (BI50) without affecting membrane permeability (assessed with propidium iodide influx) were determined to be 1, 1, and 0.5 µM for HBD2, HNP1, and LL37, respectively. We will next perform combination treatments with AMPs at BI50 and include other test strains. Findings obtained from this research may contribute to the development of novel therapies against biofilm-producing microorganisms. We thank NIH for Grant 1SC1 GM096916 (to EP), Dr. Wuyuan Lu of the University of Maryland for providing antimicrobial peptides for these studies, CSU-LSAMP for educational support, and Rabin Anouseyan and Chance Anderson for technical assistance.
Poster #: 194
Project Title: Effects of inflammation on muscle sensory afferent firing behavior in the murine extensor digitorum longus
Author List:
Zaytseva, Dasha; Undergraduate, Biological Sciences, San José State University, Presenting Author
Allawala, Anusha; Undergraduate, Biomedical Engineering, San José State University
Behnke, Stephanie; Undergraduate, Biological Sciences, San José State University, Presenting Author
Criddle, Connor; Undergraduate, Biochemistry, San José State University
Nguyen, Peter; Undergraduate, Biological Sciences, San José State University
Wilkinson, Katherine A.; Faculty, Biological Sciences, San José State University
Abstract: Inflammation is linked to a range of medical conditions, including chronic pain states and musculoskeletal disorders. Inflammatory factors such as bradykinin and reactive oxygen species have been shown to alter the response of muscle sensory afferents to mechanical stimulation (Delliaux et al. 2009), which may contribute to the development of these conditions. We hypothesized that muscle sensory afferents would show an altered response to muscle stretch following acute systemic inflammation. Inflammation was induced by an intraperitoneal injection of Lipopolysaccharide (LPS; 7.5×10^5 EU/kg; control 200 µL saline) given 18 hours prior to the experiment. The extensor digitorum longus muscle and sciatic nerve of adult male C57Bl/6 mice were dissected and placed in an in vitro bath perfused with synthetic interstitial fluid (SIF) and 100% oxygen. The nerve was suctioned into a microelectrode and population muscle sensory afferent activity was recorded in response to a series of physiological ramp-and-hold stretches at varying lengths (2.5%, 5%, 7.5% resting length). The population sensory afferent response to stretch in inflamed muscle was significantly decreased during both the dynamic and static phases of stretch (p < 0.05). Identified individual muscle stretch receptors showed a similar decreased response to stretch following inflammation. These findings suggest that altered proprioceptive information is being sent to the central nervous system during systemic inflammation. Future studies will determine if pain sensing nociceptors also show altered activity following systemic inflammation.
This work was supported by a CSUPERB President’s Commission Fellowship (DZ) and a CSUPERB New Investigator Grant (KAW)
Poster #: 195
Project Title: Isolation of Bacteria from Human Skin Producing Secreted Protease-Inhibitors
Author List:
Rogers, Umu; Undergraduate, Biochemistry, California State University, Northridge, Presenting Author
Quintero, David; Graduate, Biology, California State University, Northridge
Bermudes, David; Faculty, Biology, California State University, Northridge
Abstract: The microflora of human skin includes numerous species and their genomes that are collectively known as the human skin microbiome. It is generally thought that these microorganisms contribute to stasis in normal skin, although relatively few physiological functions of importance to skin have actually been described. Conversely, abnormal skin conditions such as atopic dermatitis are associated with the presence of bacteria that release proteolytic enzymes which break down proteins in the skin and promote inflammation. We initiated a survey of normal human skin bacteria for the production of secreted inhibitors that could suppress proteolysis by using a petri-plate based protease inhibitor assay. Skin swabs were obtained from the forehead, nose, behind the ear, back of neck, forearm, elbow, calf and knee of human volunteers, plated to blood agar and incubated in candle extinction jars at 37°C. The bacteria were then gridded to protease inhibitor plates and developed for the presence of protease inhibitors. Based on colony morphology, gram staining and catalase assays, four different putatively positive bacterial strains were obtained. 16S rRNA gene sequence identified the bacteria as Staphylococcus caprae, Staphylococcus sp., Bacillus sp. and Streptococcus sp. This study represents the first investigation of human skin specifically directed toward microbial secreted protease inhibitors and has the potential to reveal normal microbiota that contribute to stasis in normal skin. This work was supported by a CSUPERB Presidents’ Commission Scholars Award.
Poster #: 196
Project Title: Dispersion of antibiotic resistance determinants in clinical XDR Acinetobacter baumannii isolates recovered in 2014
Author List:
Fuentes, Brooke ; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Traglia, German M; Graduate
Ramirez, Maria Soledad; Faculty, Biological Science, California State University, Fullerton
Abstract: Acinetobacter baumannii is a common bacterium found in hospitals and has become resistant to multiple antibiotics. To prevent the acquisition of more resistance genes and deal with the existing ones we must understand the mechanisms available to this bacterium to incorporate new resistance genes. In this work we carried out a surveillance of different elements related to antibiotic resistance such as insertion sequences (IS), integrons, resistance islands, and antibiotic resistance genes. The surveillance was performed using 31 recent A. baumannii clinical isolates recovered from 4 different hospitals between January and July 2014. PCR reactions with different specific primers (n=22) and total DNA as template were used for the identification of different elements involved in antibiotic resistance. The results indicated that many of the strains contain various genetic elements, including: IS26, sul2, aacC2, blaOXA-23, strB, and ISAba1 (96.7%, 96.7%, 93.3%, 86.7%, and 80.0% respectively). Two insertion sequences, IS26 and ISAba1, were found in most strains, which can be responsible for the spread and/or high expression of resistance genes. We conclude that recent A. baumannii isolates contain a variety of resistance determinants and that ISs play an important role in the dissemination and expression of genes.
Grant support: NIH MHIRT 5T37MD001368
Poster #: 197
Project Title: Immune Mechanisms and Racial Disparities in Colon Cancer
Author List:
Khan, Mohammad W; Postdoc, Biology, San Diego State University
Tian, Mengxi; Graduate, Biology, San Diego State University, Presenting Author
Carethers, John M; University of Michigan, Department of Medicine
McGuire, Kathleen L; Faculty, Biology, San Diego State University
Abstract: Background: Colorectal cancer (CRC) has a disproportionate impact on African Americans (AA) characterized by aggressive disease with poorer prognosis compared to Caucasian Americans (CA). Anti-tumor immunity, characterized by anti-tumor TH1 cells and strong cytotoxic T lymphocyte (CTL) activity, has been shown quite elegantly in the literature to significantly improve disease-free survival in CA patients with CRC. But these studies have not included patients from various ethnic backgrounds, such as AA patients, although there is no reason to believe that the role of anti-tumor immunity in protection of patients from their disease will be limited to CA. We hypothesize differences in anti-tumor immunity may contribute to the racial disparity observed in CRC.
Methods: Over 250 colon tumors samples were stained using immunohistochemistry to evaluate in situ immune cell infiltration (CD8 and CD57), CTL activity (granzyme B (GzmB)), and IL-17 production. Also, using GzmB immunostaining, we analyzed the histological location of CTL activity at intratumoral vs. invasive border sites of the CRC samples. Only microsatellite stable patients have been used in this study. The samples covered 33 counties in North Carolina; amongst them 45% of the participants were AA while 55% were CA (self-proclaimed), but no follow-up data is available.
Results: The number of infiltrating CD8+, CD57+ and IL-17-producing cells do not vary statistically by race in these CRC samples. However, the analyses of CTL activity revealed that frequency of CA that are “high GzmB” responders is significantly higher than AA in both the intratumoral regions (p=0.01) and the invasive borders (p=0.0003). In addition, when IL-17 is high, both races show good correlation between GzmB expression and the presence of CD8+ immune cells (0.80 and 0.82 for AA and CA, respectively). When IL-17 is low, however, this association seems to break down in AA but not in CA (0.53 vs. 0.88, respectively, p=0.077).
Conclusion: Our data indicate that the number of CA with high numbers of GzmB expressing cells infiltrating their tumors in both intratumoral and invasive border is significantly higher than AA. In addition, IL-17 may have a modulatory effect on anti-tumor cytotoxicity by race.
Acknowledgements: We acknowledge the contributions of R Basa, V Davies, X Li, B Murali, J Shah, and B Yang. This study was funded by the NCI-CPRCHD grants (U54CA132384 and U54CA132379) and by 1U01CA162147 (to KLM and JMC).
Poster #: 198
Project Title: Effects of diet induced obesity on muscle contractile and passive properties
Author List:
Kwon, Anthony; Undergraduate, Kinesiology, San José State University, Presenting Author
Padmanabhan, Shreejit; Undergraduate, Biological Sciences, San José State University, Presenting Author
Mandawe, Remie; Undergraduate, Biological Sciences, San José State University
Wilkinson, Katherine A.; Faculty, Biological Sciences, San José State University
Abstract: The Centers for Disease Control and Prevention reported that over one-third of American adults are obese. Obesity is associated to a variety of health conditions and muscle weakness. We hypothesized that a diet induced mouse model of obesity would lead to changes in skeletal muscle contractile and passive properties in the fast twitch muscle extensor digitorum longus (EDL). C57Bl/6 adult male mice were fed either a control diet (10% kcal from fat) or a high fat diet (HFD; 60% kcal from fat) for 10 weeks. We removed the EDL muscle and placed it into a bath of oxygenated interstitial fluid (SIF). A stimulator and tissue bath electrodes were used to stimulate muscle contractions with the muscle held at the length at which the muscle can generate its maximal force, or optimal muscle length. Contraction time, half relaxation tension time, and muscle force were measured for all contraction protocols. Muscles were also subjected to a series of 27 ramps and hold stretches from optimal length to three lengths (strains) at three different speeds (strain rates). We collected tension values from six different points in the stretch: baseline, peak, 0.5 seconds after peak, 3.5 seconds after peak, end of ramp and minimum tension after stretch. The slope of the curve from the baseline to peak range was used to calculate the stiffness of the muscle. Muscle force for both active and passive tests was measured by an Aurora Force Transducer and analyzed using LabChart Software. There were no differences in muscle weight, optimal muscle length, and muscle cross sectional area. We observed no difference in contraction time, half relaxation time, muscle fatigability, or total force generated in the obese mice. No alterations in passive muscle mechanical properties during stretch and overall muscle stiffness were observed. The results suggest that 10 weeks of high fat feeding does not alter contractile or passive properties of the EDL muscle. In future studies, female diet induced obese mice will be studied to observe whether the contractile and passive properties vary between the sexes.
This work was supported by a CSUPERB President’s Commission Fellowship (SP), an SJSU Undergraduate Research Grant (AK) and a CSUPERB New Investigator’s Award (KAW).
Poster #: 199
Project Title: Identification of FOXP3+ RORγt+IL-17 producing T cells in a mouse respiratory infection model of Bordetella pertussis.
Author List:
You, Hana ; Staff, biology, San José State University, Presenting Author
Wu, Victoria; Graduate, Biology, San José State University
Ferguson, Ryan; Undergraduate, Biology, San José State University
Taylor, Marlene; Graduate, Biology, San Francisco State University
Nguyen, Tuan Andrew; Graduate, Biology, San José State University
Abstract: CD4+ T cells are subdivided into T helper type 1 (Th1), Th2 cells, and Th17 cells based on the type of cytokines they produce and are differentiated by various environmental cues. In cellular immune response to Bordetellar pertussis (B. pertussis), Th17 cells have been implicated in host defense to resolve the infection in nonhuman primates inducing a mucosal IL-17 response and long lived Th17 cells [1]. In others and our previous studies, respiratory infection with B. pertussis induced a strong late IL-17 response and long-lived Th17 cells were observed.
Regulatory T cells are the keepers of immune homeostasis. We show that in parallel to the rise of the Th17 cells, CD4+CD25+ FOXP3+ regulatory T cells were moderately increased as well during infection with B. pertussis. Surprisingly, a substantial fraction of the FOXP3+ Tregs was CCR6 and CCR7 positive, expressed RORγt+ and produced pro-inflammatory IL-17. Despite the inflammatory phenotype, lung CD4+ CD25high FOXP3+ derived from B. pertussis infection, suppress the proliferation of CD4+ T cell in an in- vitro co culture assay. Furthermore, this population is increased by IFN type I in vitro and dependent on the presence of plasmacytoid dendritic cells in vivo.
In summary, we report the increase of a specialized type of regulatory T cells during infection with B. pertussis that has not been detected previously. We speculate that this population may control the pathogenic Th17 cells type and perhaps are responsible to the compromised long lasting memory protection to B. pertussis.
Poster #: 200
Project Title: Involvement of Innate Lymphoid Cells in Bordetella pertussis Infection
Author List:
Park, Stella JungEun ; Graduate, Biology, San José State University, Presenting Author
Abstract: Introduction/Background
Whooping cough is a respiratory tract infection caused by Bordetella pertussis bacteria. Th1 and Th17 cells have been documented to be important for the resolution of B. pertussis infection and immunity in mice and primates. Data in our lab suggest a delay in Th17 response in mice infected with B. pertussis, possibly explaining the prolonged hall mark of whooping cough. IL-17 and IL-22 are the key cytokine secreted by Th17, but several other innate cells type such as the recently detected Innate Lymphoid Cells secrete these cytokines as well. Here we study the contribution of ILCs to B. pertussis pathogenesis and hypothesize that during the infection with B. pertussis, there is ILCs associated cytokine imbalance leading to the delayed Th17, and thus to a prolonged course of disease.
Methods
Using flow cytometry, we characterized ILC subtypes in lungs of BALB/c mice infected with B. pertussis at various time points post infection.
Results/Conclusion
Four distinctive groups of ILC were investigated: NCR+ ILC3, NCR- ILC3, Lti ILC3, and Intraepithelial ILC1. However, only two groups, NCR+ ILC3 and Intraepithelial ILC1 were increased at day 15 post infection with B. pertussis compared to the uninfected mice. Furthermore, these two subtypes of ILCs secreted predicted types of cytokines such as IL-22 and IFN-y. This result suggests that ILCs response seems to be delayed till day 15. The delay may have effects on the late rise of Th17 and the prolonged infection period.
Poster #: 201
Project Title: Comparison of Stroma-Associated Gene Expression in African and Caucasian American Prostate Cancer
Author List:
Zaeri, Pardis; Graduate, Biology, San Diego State University, Presenting Author
Luu, Tracy; Graduate, Biology, San Diego State University
Chen, Xin; Department of Pathology, University of CA, Irvine
Adams, Joe; Undergraduate, Biology, San Diego State University
Mercola, Dan; Department of Pathology, University of CA, Irvine
McGuire, Kathleen L; Faculty, Biology, San Diego State University
Abstract: Background: In prostate cancer (PCa), race is a major risk factor. African Americans (AA) have higher incidence and increased mortality from this disease than their Caucasian (CA) counterparts. Microarray analyses of gene expression identified altered gene expression in different pathways that are significantly associated with tumor and stromal tissues by race. 20% of these pathways are extracellular matrix components (ECM), cell adhesion molecules (CAM), and epithelial to mesenchymal transition (EMT). Most of the genes were overexpressed in CA stroma versus AA, which we hypothesize leads to less aggressive disease. The goal of this study is to reveal if the genes involved in these pathways which are mostly associated with stroma may contribute to the more aggressive nature of PCa in AA patients.
Method: We are performing IHC on tumor microarrays (TMAs) from 443 CA and 105 AA patients, to validate and extend our preliminary gene expression results. The TMAs contain duplicates of tumor, stroma, normal, and benign prostate hyperplasia tissue from each patient. They have extended follow-up data that allow biomarkers to be correlated with disease-free survival. Aperio epathology is applied to the TMA slides after staining in order to image, standardize, and analyze IHC interpretation.
Results: Microarray data using AA and CA tumor and stroma samples discovered that the majority of gene expression differences by race are associated with stroma tissue. ECM-Integrin interactions mainly determine cell adhesion properties in a tissue. It has been shown that integrin α5β1 is the key mediator of fibronectin matrix assembly, which then suppresses PCa cell invasion. In CA samples, we have over-expression of both integrin α5 and fibronectin which may suggest why AA have more aggressive forms of PCa. We confirmed this in IHC for integrin α5 and are looking at fibronectin. We are also investigating if increased tumor-associated Bone Morphogenic Protein-4 and Fibulin-5 vs. decreased stroma-associated Collagen Type 4 in AA samples suggest that tumor/stroma interactions influence these processes differentially by race.
Conclusion: Our results from IHC so far support our hypothesis that the stroma plays an important role in the racial disparities of PCa via specific ECM/CAM/EMT processes.
Acknowledgements: We acknowledge the contributions of A Sawyer and S Takahashi to these reports. This study was funded by NCI 1U01CA162147 and by a CSUPERB Joint Venture Grant to KLM.
Poster #: 202
Project Title: Exogenous Catecholamine Neuroendocrine Transmitters Modulate Growth and Biofilm Formation by Species of the Wound-Associated Microbiota
Author List:
Wagner, Clayton; Undergraduate, Department of Biological Sciences, California State University, Sacramento, Presenting Author
Fuentes, Jaime; Undergraduate, Department of Biological Sciences, California State University, Sacramento, Presenting Author
Wasurick, Ryan; Undergraduate, Department of Biological Sciences, California State University, Sacramento
Peavy, Thomas; Faculty, Department of Biological Sciences, California State University, Sacramento
Crawford, Robert; Faculty, Department of Biological Sciences, California State University, Sacramento
Abstract: Chronic wounds such as diabetic ulcers are a growing health care problem with few effective therapies. Treatment is complicated by aggregations of biofilm-embedded species of normally benign, resident skin microbiota in the wound microenvironment. Pathogenic biofilms are characterized by an extracellular matrix of sugars, polysaccharides, and DNA. The conversion of planktonic bacteria to population-dense biofilms has been extensively shown to optimize nutrient availability, enhance cell-to-cell communication, and provide resistance to the immune system and antibiotics. In turn, the persistence of bacterial ligands triggers a constant infiltration of inflammatory leukocytes that keep tissue in a persistent state of dysbiosis. Thus, a critical barrier to wound healing is the paucity of non-antibiotic therapeutics designed to inhibit microbial growth and prevent biofilm development. Prior work from our group has implicated catecholamine (CAT) neuroendocrine transmitters as factors that affect wound pathology. We hypothesize here that CATs such as epinephrine (EPI) crosstalk to commensal species and mediate transcriptomic changes associated with virulence and wound chronicity. Precedence for the idea that CATs modulate metabolic activities of the microbiota has been established by studies showing that EPI stimulates Escherichia coli biofilm formation by regulating genes required for adhesion to the cecal mucosa. To determine the effect of CATs on growth rates of prominent skin species, we grew Staphylococcus aureus and Pseudomonas aeruginosa in the presence and absence of physiological levels of EPI. Our results indicate that EPI differentially regulates growth of planktonic cells in a Gram distinction and concentration-dependent manner. CAT-mediated growth rate alterations were abrogated in rich bacteriological broths, suggesting that transcriptomic changes occur exclusively in nutrient conditions mimicking the wound microenvironment. Data from an in vitro assay developed in our lab shows that EPI increases population density and expression of secreted matrix products by S. aureus and P. aeruginosa during biofilm formation on collagen coated coverslips. Collectively, these data show that CATs modulate microbiota growth kinetics and biofilm formation and suggest a novel non-antibiotic therapeutic: translational CAT bio-inhibitors to prevent microbial persistence in chronic wounds. These studies were supported by a CSUS undergraduate research experience award.
Poster #: 203
Project Title: Structure-activity relationship of isothiazolones against a panel of Acinetobacter baumannii clinical isolates from LAC+USC medical center
Author List:
Luna, Breanna; Graduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Nykaza, Patricia; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Xu, Howard; Faculty, Biological Sciences, California State University, Los Angeles
Abstract: Background. Multidrug-resistant Acinetobacter baumannii strains have emerged to become the major cause of nosocomial and community-acquired infections worldwide, leaving limited options for treating these infections. To identify novel antibacterial compounds with activity against clinical isolates of A. baumannii, a library of compounds was previously screened via a high-throughput screen (HTS) using Escherichia coli and 55 hit compounds were obtained. Antibacterial susceptibility testing against A. baumannii strains isolated from Los Angeles County hospitals identified an isothiazolone as the most potent hit compound. The objective of this study was to test the activities of a total of seven isothiazolone analogs with different structures against 28 clinical isolates from LAC+USC Medical Center. Methods. Antimicrobial susceptibility testing was performed based on protocols of Clinical Laboratory Standards Institute. Both minimal inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) were obtained. Results. Of the seven isothiazolones tested, three exhibit potent activities against all A. baumannii isolates with an MIC of 2 μg /ml or less; these three compounds all possess chlorinated isothiazolone rings, indicative of the importance of chlorinated rings for potent activity. In addition, all seven isothiazolones have identical or similar MIC and MBC values against most clinical isolates of A. baumannii, although one compound is not potent with MIC values ranging between 32 – 256 μg/ml depending on isolates. Conclusions. Our results indicate that chlorinated isothiazolone ring is critical for a potent antibacterial property. Additionally, isothiazolones appear to act in a cidal mechanism in inhibiting growth of clinical isolates of A. baumannii. High-throughput screening of compound libraries, followed by further studies of hit compounds and derivatives, is a viable approach to the discovery of novel antibacterial compounds with activity against these pathogenic strains. Acknowledgements. Funding for this project was provided by a grant (W911NF-12-1-059) from the Army Research Office and by the CSULA LSAMP-BD Cohort XI program with funding provided by the NSF (HRD-1363399).
Poster #: 204
Project Title: Efficacy in BALB/c Mice of a Liposomal M2e Influenza Vaccine Containing the Adjuvant CD40L Following Challenge with H1N1 Virus
Author List:
Tringali, Jonathan; Graduate, Biology, California State Polytechnic University, Pomona, Presenting Author
Saperi, Amalia; Graduate, Biology, California State Polytechnic University, Pomona
Adler-Moore, Jill; Faculty, Biology, California State Polytechnic University, Pomona
Ernst, William; Molecular Express Inc.
Chiang, Suming; Molecular Express Inc.
Abstract: Introduction: We previously showed that a liposomal M2e vaccine with 15ug of the adjuvant Monophosphoryl Lipid A (MPL) produced significant protection against H1N1 influenza virus in BALB/c mice. To determine if another adjuvant, CD40L, which targets CD40 receptors on immune cells, can stimulate comparable protection against this viral challenge, the present study examined the efficacy of M2e vaccines containing 15ug MPL or different concentrations of CD40L.
Methods: Groups (Gp) of female BALB/c mice (n=22/gp) were vaccinated d0 (subcutaneously), and intranasally (i.n.) d28 and d56. Test Gps were as follows: Gp1-15ug CD40L + 50ug M2e; Gp2- 25ug CD40L + 50ug M2e; Gp3-50ug CD40L + 50ug M2e; Gp4- 50ug CD40L without M2e; Gp5-15ug MPL + 50ug M2e; Gp6-15ug MPL without M2e; Gp7- phosphate buffer (PBS). Day 60, sera were collected (n=7/Gp) and remaining mice (n=15/Gp) were challenged i.n. d77 with 10X LD50 PR8 H1N1 Influenza A. Lungs were collected (n=5/Gp) 5 days post-challenge and tested for viral burden using a foci assay. Remaining mice (n=10/Gp) were monitored for morbidity for 28 days post-challenge. Serum was tested for anti-viral precipitating antibodies (vpAb).
Results: All Gps vaccinated with M2e liposomes + MPL or CD40L had 100% survival while the Gps without M2e (Gp4 and Gp6) had 70% and 80% survival, respectively. PBS Gp (Gp7) had only 40% survival (P< 0.05, Gp 7 vs all other Gps). Although survival was not significantly different between Gps with M2e + adjuvant and Gps with just the adjuvant, all mice vaccinated with M2e + an adjuvant had significantly lower disease scores and weight loss than Gps with just adjuvant (P< 0.05). This data emphasizes how important it is to consider both disease signs and weight loss as well as survival when evaluating vaccine efficacy. In the foci assay, the results showed that mice vaccinated with M2e + MPL or CD40L had significantly lower lung viral titers than controls (Gp6 and Gp7) (P<0.05). There were also significantly higher vpAb titers in mice vaccinated with M2e + MPL or CD40L compared to the control groups (Gps 6,7 and 8) (P<0.05).
Conclusion: Taken together, the prolonged survival, reduced disease signs, weight loss, and lung viral titers with elevated anti-viral antibody levels, demonstrated that M2e liposomes containing different concentrations of CD40L or the MPL adjuvant were comparably protective against influenza challenge.
Poster #: 205
Project Title: Development of a liposomal Aspergillus fumigatus vaccine for protection against pulmonary aspergillosis in poultry
Author List:
Farah, Pamel; Undergraduate, Biology, California State Polytechnic University, Pomona, Presenting Author
Adler-Moore, Jill; Faculty, Biology, California State Polytechnic University, Pomona
Gilkes, Adrienne; Graduate, Biology, California State Polytechnic University, Pomona
Koziol, Colin; Graduate, Biology, California State Polytechnic University, Pomona
Olson, Jon; Faculty, Biology, California State Polytechnic University, Pomona
Ernst, William; Molecular Express, Inc.
Fujii, Gary; Molecular Express Inc.
McNamara, Tracey; Western University of Health Sciences, College of Veterinary Medicine
Collisson, Ellen; Western University of Health Sciences, College of Veterinary Medicine
Abstract: Introduction: Aspergillus fumigatus is the main cause of pulmonary aspergillosis (PA) in birds and mammals. Birds are very susceptible, with fewer ciliated columnar cells and heterophils lacking myeloperoxidase for fungal killing, allowing fungal spores to penetrate deep into the respiratory system. PA results in high morbidity in young birds, and in chronic infection in adult birds. Current treatment is minimally effective, and sick poultry are culled causing significant economic losses, emphasizing the need for an Aspergillus vaccine.
Methods: In Study 1 (St1), a chronic PA was established in immunocompetent Specific Pathogen Free (SPF) 55 day old chickens by infecting them mucosally with different doses of A. fumigatus spores (3.20x10ex6, 5.48x10ex7, 2.82x10ex8, 5.34x10ex8). 8 days post-challenge, lungs and trachea were collected, and colony forming units (CFU)/g determined. Having standardized the infection, we tested Aspf3 (A3), Aspf9 (A9) and Hemolysin (He) proteins conjugated via maleimide to VesiVax® Conjugatable Adjuvant Lipid Vesicles (CALV) containing monophosphoryl lipid A, in the A. fumigatus model for Study 2 (St2). A3, A9, and He proteins were each conjugated to separate CALV preparations (CALV-3Asp) and chickens were primed subcutaneously with CALV (5 or 10ug of each protein/dose), CALV without protein or buffer at 10 days old, and mucosally boosted at 31 days and 52 days of age. Day 55, chickens were challenged mucosally with 5x10ex8 A. fumigatus conidia; 8 days later, lungs and trachea were collected for CFU/g.
Results: In St1 a dose of 5x10ex8 conidia produced a moderate infection in lungs and trachea of chickens (1.1x10ex2 CFU/g lung and 2.6x10ex2 CFU/g trachea). This dose was used to challenge chickens in St2. In St2, chickens previously vaccinated with 5ug, but not 10ug, of each protein/dose had significantly lower fungal burden in their lungs vs both controls after fungal challenge (P<0.03) and significantly lower fungal burden in their tracheas vs CALV control (P=0.01).
Conclusions: Given that prior vaccination of chickens with CALV-3Asp vaccine (5ug of each protein/dose) was able to significantly lower the fungal burden in both the lungs and trachea, following challenge with A. fumigatus, this vaccine may provide a promising option for preventing/minimizing the severity of pulmonary aspergillosis in avian species.
Poster #: 206
Project Title: Comparative Efficacy Against HSV-2 Challenge in Mice Vaccinated with HSV-2 gD Tripeptide Liposomal Vaccines Containing Different Adjuvants
Author List:
Guardado, Eleana; Graduate, Biology, California State Polytechnic University, Pomona, Presenting Author
Chavez, Elena; Graduate, Biology, California State Polytechnic University, Pomona
Rubio, Jennifer; Graduate, Biology, California State Polytechnic University, Pomona
Zadorian, Sarineh; Graduate, Biology, California State Polytechnic University, Pomona
Adler-Moore, Jill; Faculty, Biology, California State Polytechnic University, Pomona
Ernst, William; Molecular Express Inc.
Chiang, Suming; Molecular Express Inc.
Abstract: Background: 1 in 6 people in the United States are infected with HSV-2. Although this infection usually localizes in the genital area, it can become a life threatening systemic infection in immunosuppressed individuals and neonates, and can increase susceptibility to HIV infection. In this study we examined the protection against intravaginal infection, generated by a liposomal HSV-2 tripeptide epitope vaccine (tri-gD) containing monophosphoryl lipid A (MPL), or the immune cell targeting protein, CD40 ligand (CD40L), with or without the TLR9 adjuvant, CpG.
Methods: Vaccines were administered subcutaneously to BALB/c mice d0, d28, and d56. Mice (n=17/Group, Gp) were treated as follows: tri-gD at 5ug or 15ug/dose + 25ug CpG,; 5ug tri-gD/dose + 15ug CD40L + 25ug CpG; 15ug tri-gD/dose + 15ug or 25ug CD40L; 15ug tri-gD/dose + 15ug MPL. Controls were given only 25ug CpG, CD40L or 15ug MPL. Day 59 or 60, spleens were collected (n=7/Gp) for cytokine evaluation by ELISpot assay. Day 70 mice (n=10/Gp) were challenged with 10X LD50 HSV-2, G strain, vaginal swabs collected d72 for viral burden analysis and then monitored for morbidity to d92.
Results: Survival of mice given 15ug tri-gD/dose + 15ug MPL was the best (80%) (p=0.0012 vs all control Gps, 10-30%). Although survival with 15ug tri-gD + 25ug CD40L (50%) or 5ug tri-gD + 25ug CpG (40%) was not as high, it was still significantly better than the 15ug MPL control (10% survival) (p=0.05 and p=0.03, respectively). Paralleling the survival data, the Gp given 15ug tri-gD + 15ug MPL had less weight loss (p=0.004), mucosal signs (p=0.008), and neurological signs (p=0.009) vs all control Gps. Gamma interferon levels were elevated in the mice given 15ug tri-gD + 15ug MPL compared to those mice given tri-gD + CD40L or CpG suggesting that the 15ug tri-gD + 15ug MPL vaccine stimulated a better Th1 response.
Discussion: Protection against HSV-2 intravaginal challenge was significantly better in mice vaccinated with 15ug tri-gD + 15ug MPL compared to the other Gps, as indicated by enhanced survival, less weight loss, mucosal and neurological signs. Given that this vaccine also stimulated higher levels of gamma interferon, its better performance may be related to a greater stimulation of the Th1 response.
Poster #: 207
Project Title: The identification of Major Histocompatibility Complex (MHC) class II alleles in rhesus macaques
Author List:
Gilpin, Trey; Undergraduate, Biology, California State University San Marcos, Presenting Author
Dow, Courtney; Staff, Biology, California State University San Marcos
Bohn, Patrick; UW-Madison
Karl, Julie; UW-Madison
Wiseman, Roger; UW-Madison
Sette, Alessandro; LIAI
Mothé, Bianca; Faculty, Biology, California State University San Marcos
Abstract: One leading cause of death from infectious disease is Tuberculosis (TB) due to the pathogen Mycobacterium tuberculosis (MTB). One third of all humans (~2 billion people) are infected with latent MTB, resulting in 2 million deaths, and 9 million reported new infections annually. The Bacille Calmette Guérin (BCG) vaccine is currently the only licensed TB vaccine, but protection against TB is incomplete and variable. In regions common with HIV/TB co-infection, the vaccine is useless as immuno-compromised individuals are unable to mount the proper immune response upon vaccination. It is clear more preventative and effective measures are crucial, making new vaccine research extremely important. To address this issue, we evaluated the Major Histocompatibility Complex (MHC) class II genes present in a cohort of 37 rhesus macaques by deep sequencing consisting of multiple platforms, including 454 and Miseq. The most common DRB haplotype included the alleles Mamu-DRB1*03:03 and Mamu-DRB1*10:07 and was expressed by 43% of our cohort. Likewise, the most common DQ haplotype included Mamu-DQA1*26:01 and Mamu-DQB*18:01 alleles which were expressed by 49% of this cohort. The identification of these alleles will provide a platform for the characterization of natural or vaccine-induced immune responses.
Acknowledgments: Colleen Lopez for assisting with training Trey Gilpin. The RISE program and OTRES, RISE Grant GM-64783 and 1 R15Al064175-01 Grant.
Poster #: 208
Project Title: A Cell-Based Assay to Monitor Proteolytic Events on the Cell Surface
Author List:
Dharmawan, Andre; Graduate, Biology, San Diego State University, Presenting Author
Stolp, Zachary; Graduate, Biology, San Diego State University
Smurthwaite, Cameron; Staff, Biology, San Diego State University
Wolkowicz, Roland; Faculty, Biology, San Diego State University
Abstract: Proteolysis is an essential biological process as it serves different biological purposes, such as protein activation, degradation of aggregates, and regulation of many cell functions. While a large number of proteolytic events occur in the intracellular secretory pathway of the trans-Golgi network, extracellular proteolysis at the cell surface and extracellular matrix (ECM) play significant roles in the progression of diseases, as exemplified by the role of Matrix Metalloproteinase 14 (MMP-14) in cancer.
MMP-14 is a ubiquitously-expressed cell surface protease known to activate several soluble MMP’s via extracellular proteolysis. Active soluble MMP’s are used for the restructuring of the ECM that facilitates cells migration and development. MMP-14 is known to be highly expressed in cancer tissue as cells require constant remodeling of ECM for fast replication and migration. Currently, there is a need to find novel MMP-14 inhibitors in an effort to block cellular transformation and metastasis. No cell-based assays that can be used to monitor cleavage event on the cell surface are available to find such inhibitors.
Therefore, we are proposing to develop a cell-based assay to monitor cleavage event on the cell surface using an optimized substrate of MMP-14 as a proof-of-principle. The assay will also serve as a screening tool for the search MMP-14 inhibitors. The assay is based on a two-tag system (FLAG and HA) flanking the substrate under study, which can distinguish cleavage and non-cleavage event. A C-terminal mCitrine fluorescent protein is used as marker for cell surface localization by fluorescence microscopy. We have previously shown that such two-tag system can be used to monitor intracellular cleavage within the secretory pathway utilizing a Furin protease substrate.
Retroviral technology was used for the stable expression of the assay elements in mammalian cells. The utility of the assay for monitor cleavage on the cell surface with be demonstrated with the overexpression of MMP-14. Once the assay is proved to function as intended, it could also be used as platform to monitor other biologically important surface proteolysis events such as cleavage of the Amyloid Precursor Protein in Alzheimer disease, hemagglutinin proteolysis of incoming influenza virus, or proteolysis of sialic acid by the influenza virus neuraminidase (NA) for the spread of viral particles.
Poster #: 209
Project Title: Characterization of sRNAs regulated by the ExoS/ChvI signaling pathway in Sinorhizobium meliloti
Author List:
Chang, Emily V.; Graduate, Biological Science, California State University, Fullerton, Presenting Author
Mendoza, N. Carolina; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Chen, Esther; Faculty, Biological Science, California State University, Fullerton
Abstract: The nitrogen-fixing bacterium Sinorhizobium meliloti forms a symbiosis with the host plant Medicago sativa (alfalfa), enabling the legume plant to grow in nitrogen poor conditions. The S. meliloti ExoS/ChvI signaling pathway is a two-component system that regulates many genes important for the symbiosis. Small RNAs (sRNAs) have been recently discovered to be important regulators of gene expression in many bacteria, including S. meliloti. Previous work in our lab identified 30 sRNA genes as candidates for transcriptional regulation by ExoS/ChvI. Because ExoS/ChvI has such an important role in the symbiosis, we hypothesize that some of the 30 sRNA genes might also have a role in the symbiosis. To test whether the expression of these sRNAs is indeed controlled by ExoS/ChvI, total RNA from three S. meliloti strains (wild-type, chvI gain-of-function mutant, and chvI partial loss-of-function mutant) was extracted and used for Northern hybridizations. Thus far, for the sRNA gene SmelC289, we observed higher expression in the chvI gain-of-function mutant and lower expression in the chvI partial loss-of-function mutant compared to wild-type, indicating that ChvI positively regulates the expression of SmelC289. In future experiments, we will determine whether ChvI regulates the other sRNA genes, and construct knockout strains for SmelC289 and other ChvI-regulated sRNAs to assess whether those sRNAs are involved in symbiosis. Thus, discovering sRNA genes that are regulated by the ExoS/ChvI two-component system will clarify the role of sRNAs in the symbiosis between S. meliloti and alfalfa.
Funding for this project has been provided by NSF grant IOS-0818981 to E.J.C.
Poster #: 210
Project Title: Development of a novel cell-based assay for monitoring frameshifting of the Hepatitis C virus
Author List:
Zamora, Steven; Undergraduate, Biology, San Diego State University, Presenting Author
Nassiri, Yousef; Graduate, Biology, San Diego State University, Presenting Author
Williams, Wesley; Graduate, Biology, San Diego State University
Smurthwaite, Cameron; Staff, Biology, San Diego State University
Wolkowicz, Roland; Faculty, Biology, San Diego State University
Abstract: Hepatitis C virus (HCV) is an enveloped, positive-sense single-stranded RNA virus and represents a prototypical member of the Flaviviridae family. The virus primarily resides in the liver and causes a strong immune response which can lead to inflammation, cirrhosis and ultimately liver cancer. Upon infection the viral genome is translated into a single long polyprotein product, which is then further processed into the ten mature and active proteins. Translation of the HCV genome yields 10 proteins, the first one Core, is essential for the viral lifecycle. The genome is flanked at both 5’ and 3’ ends by untranslated regions (UTRs). The 5’ UTR functions as an Internal Ribosome Entry Site (IRES) for the enabling of cap-independent viral translation. The IRES recruits ribosomes without the need for initiation factors, which then proceed to translate the first viral protein Core. Interestingly, during the translation of Core ribosomal frame shifting has been observed, leading to the translation of highly uncharacterized Alternative Reading Frame Products (ARFPs), also known as F-proteins. Little is known about the importance of frameshifting for HCV, if the cellular machinery influences frameshifting and what are the effect of ARFPs on Core and the viral life cycle.
Here we have undertaken the goal to develop a novel cellular assay for the monitoring of frameshifting in the context of HCV utilizing flow cytometry. The assay will be ultimately intended to track frameshifting based on the expression of the green fluorescent protein (GFP) in the three different open reading frames (ORFs). For that purpose, we have utilized retroviral technology to express a first set of plasmids that utilize the HCV IRES for the translation of the N terminus of Core fused to GFP in the three ORFs. Our preliminary results show that, while most of the translation is due to a non-shift event (as expected), we are able to observe +1 and +2 frameshift as well.
The development of such an assay will represent the first assay of its kind. Moreover, it will allow us to discern the role cellular factors, viral ARFPs and the 3’ UTR, may play in the viral life cycle and the modulation of replication/transcription and translation.
Poster #: 211
Project Title: Investigating viral proteolytic cleavage of Flaviviridae Non-Structural 3 protein in a cell-based context
Author List:
Khamo, Intisar; Graduate, Biology, San Diego State University, Presenting Author
Bichara, Veronica; Graduate, Biology, San Diego State University, Presenting Author
Dharmawan, Andre; Graduate, Biology, San Diego State University
Fetsko, Alexandra; Graduate, Biology, San Diego State University
Smurthwaite, Cameron; Staff, Biology, San Diego State University
Luu, Yen; Undergraduate, Biology, San Diego State University
Rice, Trevor; Undergraduate, Biology, San Diego State University
Wolkowicz, Roland; Faculty, Biology, San Diego State University
Abstract: Infection rate from viral pathogens including Hepatitis C Virus (HCV), Dengue Virus (DenV), and West Nile Virus (WNV) is a true health concern, where in some cases outbreaks are observed around the globe. They can cause, respectively, liver cirrhosis, Dengue hemorrhagic fever and meningitis/encephalitis. These viruses pertain to the Flaviviridae, a family of viruses containing an error-prone RNA polymerase giving rise to frequent mutations that can result in immune escape and resistance. While few antivirals exist against HCV, no vaccines or antiviral treatments are available for DenV or WNV, highlighting the need for further investigation to discover new antivirals, and the tools necessary to find them.
One of the primordial steps in the Flaviviridae viral life cycle is the processing of the proteome, carried out by host and viral proteases. As a specific target for drug design, we focused on the viral protease (PR) encoded in the genome. We utilize a strategy that exploits the autocatalytic properties of the viral NS3 PR in a fusion context with the well-studied yeast transcription factor Gal4. The DNA-binding domain (DBD) and transcriptional-activating domain (TAD) of Gal4 are separated by NS3 and its cofactor NS2B. Upon translation of this fusion in the cell, monitoring of cleavage events are evaluated based on Gal4 promoter-driven expression of the reporter Green Fluorescent Protein (GFP), which can only be achieved in the presence of intact DBD/TAD fusion. Two distinctive conditions can arise: 1) In the presence of cleavage, the Gal4/PR fusion is destroyed due to the activity of wild-type PR, resulting in no GFP induction. 2) In the absence of cleavage due to mutated or inhibited PR, DBD/TAD fusion remains intact, traveling to the nucleus and inducing GFP expression. In short, proteolytic cleavage by PR is closely monitored based on green fluorescence or lack of. The assay was further developed to robustly monitor PR activity in an inducible manner through retroviral technology to protect the cells from possible cytotoxic effects due to PR overexpression. The assay was also tested in different cell types.
Utilizing flow cytometry, this cell-based assay provides a platform for the high-throughput screening for novel inhibitors of HCV, DenV and WNV. While the main purpose of the assay is to drastically facilitate drug discovery, we hope to provide further biological understanding on the activity of the viral proteases and their respective cofactors.
Poster #: 212
Project Title: Variation in central metabolic and stress genes along a climatic gradient in montane populations of a leaf beetle
Author List:
Roberts, Kevin; Graduate, Biology, Sonoma State University, Presenting Author
Deyarmin, Jared; Undergraduate, Biology, Sonoma State University, Presenting Author
Mardulyn, Patrick; Université libre de Bruxelles
Wheat, Christopher; Stockholm University
Dahlhoff, Elizabeth; Santa Clara University
Rank, Nathan; Faculty, Biology, Sonoma State University
Abstract: Many montane organisms live in fragmented populations that are especially vulnerable to climate change. The ability of small populations to persist depends partly on whether they possess genetic variation in their capacity to respond and adapt physiologically to altered environments. In the Sierra Nevada Mountains of California, the willow leaf beetle Chrysomela aeneicollis occurs at high elevations just below tree line (2400-3600 m). Populations experience highly variable environmental temperatures, ranging from 0°C to 30°C in a 24 hour period. Variation at genetic marker loci shows significant differentiation among montane drainages along a 75 km transect from the King’s River in the southwestern Sierra to Rock Creek in the eastern Sierra. With the increasing accessibility to Next-generation sequencing, whole-genome approaches to novel species are more available. Using pool-seq on a genetically diverse central population, we have been able to look at allelic frequencies of 156 genes involved in central metabolism and stress response and have identified SNPs in 90% of them. Using this data as a framework, we are currently investigating how these genes vary along latitudinal and elevational thermal gradients. This will allow us to see what genes could potentially be under temperature selection. Support for this project was provided by the CSUPERB Joint Venture Grant Program and the NSF.
Poster #: 213
Project Title: Effects of Anti-Cancer Reagents on the Invasiveness of Cancer Cells
Author List:
GARIMIDI, PRATHYUSHA; Graduate, BIOLOGY, California State University Channel Islands, Presenting Author
MYTYCH, JOSHUA; Undergraduate, BIOLOGY, California State University Channel Islands, Presenting Author
KENNEDY, SHANE; Undergraduate, BIOLOGY, California State University Channel Islands
PARMAR, NITIKA; Faculty, BIOLOGY, California State University Channel Islands
Abstract: Invasiveness is a characteristic feature of malignancy in cancer and can greatly reduce the five-year survival rate of patients affected. This study aimed to determine the impact of five proposed anti-cancer agents (Berberine chloride, Azathioprine, Gossypol, Miltefosine, and Etoposide) on three female cancer cell lines: MES-SA (uterine), C33A (cervical), and SKBR (breast). We hypothesized that treatment with these agents would decrease invasiveness based on our previous findings of their growth inhibitory properties.
Invasiveness was tested using the CultreCoat® 96 Well Medium BME Cell Invasion Assay. The cancer cell lines were grown to 80-90% confluency and then treated with the proposed anti-cancer agents at a 2µM for 24 hours. Cells were harvested and subsequently seeded in the invasion chamber for 24 hours. Migration of the cells, reflecting invasiveness, was monitored via a fluorimetric assay and quantified. Untreated cells served as controls.
Invasiveness was influenced by the type of reagent and cell line. Miltefosine affected a decrease in invasiveness of SKBR by 35%, with no other statistically significant changes in the invasiveness of other cell lines observed. Treatment with Gossypol increased invasiveness in all cell lines; 19% in C33A, 135% in SKBR, and 235% in MES-SA. Treatment with Azathioprine increased invasiveness in SKBR by 30%, and even more in C33A (141%); however, it did not increase in MES-SA. Berberine chloride reduced the invasiveness of SKBR by 33%, and C33A by 137%. The agent that showed the greatest reduction in invasiveness was Etoposide, with a decrease of 13%, 71%, and 182% in SKBR, MES-SA, and C33A respectively. Agents that showed an increase in invasiveness could have their potential as anti-cancer therapy greatly reduced, even if they have growth inhibitory properties. Agents that showed no impact on invasiveness could potentially be worth investigating further if they have other anti-cancer properties. Agents reducing invasiveness (particularly, Etoposide and Berberine Chloride) should be considered for further study, especially in C33A, the cell line most respondent to these agents. A dose-dependent impact on invasiveness is currently being studied on a variety of cancer cells as well as a non-cancerous control. Targeting invasiveness in these aggressive cell lines may lead to a potential lead.
Poster #: 214
Project Title: Characterizing and Manipulating iMSC Fate Progression in Skeletal Muscle
Author List:
Perez Carbajal, Edgar; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Wosczyna, Michael, Veterans Affairs Palo Alto Health Care System and Stanford University School of Medicine, Stanford
Rando, Thomas, Veterans Affairs Palo Alto Health Care System and Stanford University School of Medicine, Stanford
Abstract: Skeletal muscle regeneration is postulated to involve interstitial mesenchymal stem cells (iMSCs) residing in myogenic (muscle) tissue interstitium. The interstitium is composed of the connective tissue between muscle fibers from which nonmyogenic iMSCs are thought to secrete promyogenic factors upon muscle injury. These promyogenic factors cause myogenic cells within the lamina of muscle fibers to differentiate, thus inducing muscle repair. However, iMSCs are also a potential cell-of-origin for the abnormal tissues associated with skeletal muscle disorders, such as muscular dystrophy, due to their multipotent characteristics. iMSCs have been shown to differentiate into fibroblasts, a.k.a. connective tissue cells, osteocytes, a.k.a. bone cells, and adipocytes, a.k.a. fat cells. MicroRNAs (miRNAs) are short non-coding RNA sequences that bind to the 3’ untranslated region of messenger RNA (mRNA) transcripts and usually downregulate the translation of mRNAs into proteins. The potential modulation of cell fate through microRNAs, capable of directly influencing gene translation, represents a treatment for skeletal muscle disorders by being able to inhibit the formation of abnormal tissues within skeletal muscle. Here we characterized the classic iMSC adipogenic program, which is marked by changes in protein expression during differentiation, and found that platelet-derived growth factor receptor alpha (PDGFRa) and nuclear-localized peroxisome proliferator-activated receptor gamma (PPARy) expression decreased and increased, respectively, during adipogenesis. Candidate microRNAs predicted to inhibit adipogenesis were able to prolong the expression of PDGFRa and inhibit the nuclear localization of PPARy in iMSCs cultured in adipogenic media. These microRNA-induced changes to the classic gene expression characterized for adipogenesis show that microRNAs are indeed able to inhibit adipogenesis. Current work aims to identify the genes regulated by these candidate microRNAs as potential therapeutic targets for manipulating adipogenesis in iMSCs as a form of therapy against abnormal tissue growth.
Poster #: 215
Project Title: The role of ITGA1 in pancreatic cancer
Author List:
Kim, Sa La; Undergraduate, Biology, California State University, Northridge, Presenting Author
Adamian, Yvess; Staff, Biology, California State University, Northridge
Brambilla, Daniel; Undergraduate, Biology, California State University, Northridge
Hoover, Malachia; Graduate, Biology, California State University, Northridge
Kelber, Jonathan; Faculty, Biology, California State University, Northridge
Abstract: Pancreatic ductal adenocarcinoma (PDAC) is currently the fourth leading cause of cancer-related deaths in the United States and the typical five-year survival rate for patients is less than 5%. PDAC is an invasive malignancy that is difficult to detect early and commonly resistant to therapeutic interventions. Thus, a more complete profiling of molecular regulators in PDAC during disease progression will aid in making novel discoveries to improve diagnostic and treatment methods. Both local invasion and systemic metastases from epithelial-based cancers are driven by pseudopodia/invadopodia formation and function. In this regard, we previously identified PEAK1 (Pseudopodium-Enriched Atypical Kinase One) as a novel regulator of tumor growth/metastasis and therapy resistance in human cancers. To identify co-regulators of pseudopodia formation and pancreatic cancer progression, we cross-referenced our previously published list of pseudopodium-enriched (PDE) proteins with the Oncomine and Babelomics online resources, allowing us to identify novel genes that have yet to be characterized in pancreatic cancer. Of these novel genes, ITGA1 (a cell surface receptor for collagen) is significantly upregulated in pancreatic cancer, yet there are no published reports on the functions of this gene in PDAC. Interestingly, we also found that the expression of ITGA1 increases in PDAC tissues that harbor inactivating mutations in the Smad4 gene, a common genetic alteration in later stages of PDAC. Our molecular analysis of PDAC cells indicates that ITGA1 is expressed at the highest levels in KRas-mutant lines that display a less differentiated morphology. We also found that ITGA1hi PDAC cells are enriched for ALDH1 activity – an indicator of stem-like properties. We evaluated changes in cell cycle profiles of four PDAC cell lines on different ECM substrates in response to various arresting agents. Interestingly, PANC1 cells underwent a significant induction of apoptosis when grown under serum starved conditions on fibronectin or laminin substrates. However, collagen inhibited this serum-starvation induced apoptotic response suggesting that ITGA1 may promote the survival of KRas-mutant PDAC cells when exposed to extracellular stress (e.g., nutrient deprivation). Thus, targeting cell-surface ITGA1 may be a viable mechanism for inhibiting PDAC cell proliferation. Future studies will evaluate the function of ITGA1 in PDAC cells using RNAi and/or immunoneutralizing methods.
Poster #: 216
Project Title: RAI14 regulates pancreatic cancer cell proliferation, migration and response to Src kinase inhibition
Author List:
Adamian, Yvess; Staff, Biology, California State University, Northridge, Presenting Author
Brambilla, Daniel; Undergraduate, Biology, California State University, Northridge
Wallace, Brandon; Undergraduate, Biology, California State University, Northridge
Hoover, Malachia; Graduate, Biology, California State University, Northridge
Kelber, Jonathan; Faculty, Biology, California State University, Northridge
Abstract: Pancreatic ductal adenocarcinoma (PDAC) is a deadly disease (less than 5% of patients survive beyond 5 years) due to poor diagnostic and treatment methods. Since pancreatic cancer is a highly invasive and metastatic disease, we reasoned that the proteomic signature from a critical subcellular compartment that mediates cell movement (i.e., the pseudopodia) may be a good pool from which to identify novel biomarkers or therapeutic targets in this disease. In fact, we were previously successful in this effort and identified and characterized the new non-receptor tyrosine kinase PEAK1. To identify co-regulators of pseudopodia formation and pancreatic cancer progression, we cross-referenced our previously published list of pseudopodium-enriched (PDE) proteins with the online Oncomine database and Babelomics resources, allowing us to identify novel genes yet to be characterized in pancreatic cancer. Of these genes, RAI14 (Ankycorbin), is significantly upregulated in human pancreatic cancer samples and has been previously reported to bind and regulate the actin cytoskeleton. We first characterized motility and proliferation properties of four PDAC cell lines and found that motility and proliferation properties increased with mesenchymal character when oncogenic KRAs mutations were present. Interestingly, among these cell lines RAI14 was expressed at the highest levels in the atypical PDAC cell line BxPC3 that does not contain the oncogenic KRas mutation, followed by the KRas-mutant, but –independent, PDAC cell line PANC1. As previously reported, we confirmed that RAI14 colocalizes with the actin cytoskeleton in PANC1 cells. Importantly, RAI14 knockdown in both BxPC3 and PANC1 cells reduces motility and proliferation on fibronectin substrates. A previous study identified high levels of RAI14 expression among the NCI-60 cell line panel as an indicator of resistance to dasatinib (Abl and Src kinase inhibitor). Since Src kinase is a well-known driver of PDAC progression, we next sought to analyze the role of RAI14 in regulating Src activity. Not only did we find that RAI14 is required for Src activity, but we also found that reducing RAI14 levels reduced total protein levels of both Src kinase and GAPDH. Taken together, these results suggest that RAI14 regulates PDAC cell phenotypes via Src and may also regulate the glycolytic shift that commonly occurs in tumor cells to promote survival.
Poster #: 217
Project Title: Herceptin resistance correlates with brain-specific metastatic potential of HER2-poisitive breast cancer cells
Author List:
Molnar, Justin; Graduate, Biology, California State University, Northridge, Presenting Author
Agajanian, Megan; Graduate, Biology, California State University, Northridge
Campeau, Anaamika; Staff, Biology, California State University, Northridge
Kelber, Jonathan; Faculty, Biology, California State University, Northridge
Abstract: HER2 (human epidermal growth receptor 2) is over-expressed in about 25% of breast cancers, and as a result the FDA approved Herceptin (trastuzumb, Genentech – a humanized monoclonal antibody against HER2) to treat this disease and improve patient outcome. Still, acquired and innate resistance to this therapy is a significant clinical hurdle. The chorioallentoic membrane (CAM) of chicken embryos provides a suitable microenvironment for tumor xenograft studies due to their immuno-deficiency, requiring less time than murine models, and vascularization that enables systemic metastasis. However, this model has never been used for the analysis of HER2-positive breast cancer cells (BCC), making the the aim of the current study to establish this as a viable method for studying this subset of breast cancer. We tested two HER2-positive BCC lines for their primary tumor growth and metastatic potential. While both form macroscopic primary tumors, the AU565 cells (Herceptin-resistant) grew two orders of magnitude slower at the primary tumor site, but metastasized to the brain five times more efficiently. Importantly, this is the first quantitative evidence suggesting that Herceptin resistance correlates with brain-specific metastatic potential. We hypothesize that these observations for the AU565 cells may be a result of high PEAK1 expression. PEAK1 is a novel non-receptor tyrosine kinase that was previously identified by our lab to promote tumor initiation, progression and resistance to anti-cancer therapies. Notably, our lab has identified dual roles for PEAK1 in both tumor-associated fibroblast and epithelial cell compartments. Using this CAM assay, we discovered that when PEAK1-expressing fibroblasts were co-xenografted into the chick CAM with either SKBR3 or AU565 cells, they decreased metastasis of the SKBR3 cells to the brain while increasing the overall tumor burden from the AU565 cells. These results suggest Herceptin resistant HER2-positive cells are more susceptible to pro-tumorigenic paracrine signaling in the tumor microenvironment. The fact that PEAK1 expression is high in both the tumor and fibroblast cells indicates that PEAK1 may be a viable drug target in multiple HER2-positive breast cancer cell types for reducing tumor progression and sensitizing patients to Herceptin.
Poster #: 218
Project Title: Characterization of the overexpression of miR-206 during early muscle development in Xenopus laevis
Author List:
Blandino, Rebecca; Undergraduate, Biology, San Francisco State University, Presenting Author
Domingo, Carmen; Faculty, Biology, San Francisco State University
Abstract: MicroRNAs (miRNAs) are small, non-coding sequences of RNA that regulate genes post-transcriptionally. They bind to specific messenger RNAs and block translation. miRNAs have been shown to play a role during embryonic development and in diseases. Of the wide variety of miRNAs, our lab is interested in miR-206 because it is exclusively expressed in cells that will give rise to the skeletal muscle of vertebrates. To understand the role that miR-206 plays in muscle development we use a mimic to overexpress miR-206 in the embryo. We hypothesize that increased levels of miR-206 may lead to changes in gene expression levels of target genes that are important in muscle development. To test this hypothesis, we have injected miR-206 mimics into one of the two blastomeres along with green fluorescent protein in order to visualize the shapes of cells as they form muscle in the developing frog embryo, Xenopus laevis. We used confocal imaging system to analyze the cell shape changes that underlie muscle formation. Our results show that there is a lag in somite rotation as well as in myotome alignment. These results suggest that miR-206 plays an important role in regulating early tissue morphogenesis during vertebrate development.
Poster #: 219
Project Title: CRISPR/Cas9-mediated knockout of TMEM176 proteins associated with cancer pathology
Author List:
Campbell, Dewayne; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Alsky, Travis; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Habibi, Ania; Graduate, Biological Science, California State University, Fullerton
Cuajungco, Math; Faculty, Biological Science, California State University, Fullerton
Abstract: Two transmembrane (TMEM) proteins, namely TMEM176A and TMEM176B, were reported to play a role in immune cell function. TMEM176A was discovered based on the findings that its transcripts are highly elevated in liver cancer or kidney proteinuria. On the other hand, TMEM176B was identified owing to its high expression in normal lungs and association with immune tolerance of allografts. We previously reported that TMEM176A and TMEM176B protein levels were significantly elevated in lymphoma compared with normal, non-cancerous lymph tissues. Meanwhile, the protein levels of TMEM-176A, but not TMEM176B, were also significantly elevated in lung cancer tissues. Further analysis of the protein expression ratio of TMEM176A over TMEM176B revealed significant differences between normal and cancer tissues of the breast, lymph, skin (melanoma), and liver. We hypothesize that TMEM176A and TMEM176B are possibly involved in the cancer cell-mediated evasion of immune surveillance. To analyze their function in cells, we employed the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats with Cas9 nuclease) technology to knockout protein expression. Guide RNA (gRNA) targeting TMEM176A or TMEM176B were created using online bioinformatics tools and cloned into a U6 promoter driven expression vector. The gRNA and Cas9 were then co-transfected into human embryonic kidney cells (HEK)-293 cells. Preliminary results showed that the CRISPR/Cas9 technique is effective in disrupting the expression of TMEM176A and TMEM176B in HEK-293, and are comparable with our findings using RNA interference technique. When immune cells were knocked down or knocked out of the TMEM176A protein, the cells showed similar cytokine profile with cells exposed to lipopolysaccharide, suggesting that these cells were already activated (mature). Therefore, the creation of human cell lines devoid of TMEM176A and/or TMEM176B is a first step to assess whether one or both proteins could influence the tumorigenic potential of cells and immune tolerance of cancer cells. Future investigations using immunological assays could provide additional data on the role of each protein in immune tolerance and cancer pathology.
This work was funded by the NIH R15 NS070774 grant and the CSUF Intramural Grants Program.
Poster #: 220
Project Title: Investigating the genetic pathway driving ER dynamics in Drosophila melanogaster
Author List:
Beyeler, Sarah; Undergraduate, Biology, San Francisco State University, Presenting Author, Nagel Award Finalist
Hoffman, Heidi; Undergraduate, Biology, San Francisco State University
Sims, Amanda; Graduate, Biology, San Francisco State University
Riggs, Blake; Faculty, Biology, San Francisco State University
Abstract: The endoplasmic reticulum (ER) is the largest organelle in the cell and recently has been shown to change its shape and localization throughout the cell cycle, experiencing the most dramatic changes during mitosis. It has been suggested that these dynamic changes are the result of the homotypic fusion and fission events of the ER. A prior study has shown that homotypic fusion is mediated by integral membrane GTPase Atlastin (Atl), however the pathway driving these dramatic rearrangements is poorly understood. Here we are investigating the interaction between Atl and the integral membrane ER shaping proteins Reticulon-1 (Rtnl1) and Lunapark (Lnp) in Drosophila melanogaster. Our hypothesis is that Atl is regulating the interactions between Rtnl1 and Lnp in a GTP dependent manner mediating homotypic fusions events. To investigate our hypothesis we created 3 different transgenic Drosophila lines containing Gal4-UAS mediated RNAi inhibition of Atl, Rtnl1, and Lnp. Each line was driven in the Drosophila compound eye and examined for a phenotype. Expression of Atl-RNAi displayed a rough eye phenotype in 60% of the progeny, while expression of Rtnl1 and Lnp did not exhibit a phenotype in the eye. Based on our preliminary findings, we plan to examine Rtnl1-RNAi and Lnp-RNAi in combination with Atl-RNAi and examine the compound eye for either an enhancement or suppression of the rough eye phenotype. These results would indicate that Rtln1 and Lnp are in the same pathway as Atl, and provide the bases for a modifier screen of the Drosophila genome.
Poster #: 221
Project Title: Phenotypic analysis of Sinorhizobium meliloti strains overexpressing the smb20809 and smc02832 genes to understand gene function
Author List:
Eng, David J.; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Dillague, Criselda; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Chen, Esther; Faculty, Biological Science, California State University, Fullerton
Abstract: Endosymbiosis is a mutualistic relationship between the bacterium Sinorhizobium meliloti and its legume plant host Medicago sativa where the bacteria fixes nitrogen for the plant, which in return supplies the bacteria with carbon sources. The S. meliloti ExoS/ChvI two-component system pathway is important for successful endosymbiosis, which is important agriculturally for legumes to grow in soil with low nitrogen content. ExoS/ChvI also regulates many functions in free-living bacteria such as exopolysaccharide production, nutrient utilization, and cell envelope integrity. Previous studies in our lab have identified many genes in S. meliloti that are transcriptionally regulated by ExoS/ChvI. Here, we characterize two of these genes, smc02832 and smb20809, in order to better understand the function of these genes. The smb20809 gene, also called kpsF1, encodes arabinose-5-phosphate isomerase, which is involved in capsular polysaccharide synthesis. The smc02832 gene encodes a periplasmic solute-binding protein of an ATP binding cassette (ABC) transporter for amino acids. We have generated overexpression plasmids for both genes and introduced the plasmids into both a S. meliloti wild type (WT) strain and the partial loss-of-function chvI K214T mutant strain. We observed growth of the overexpression strains on different types of media to assess whether overexpression of these genes affected exopolysaccharide production, nutrient utilization, or cell envelope integrity. Our initial results show that overexpression of smb20809 in WT impairs growth on minimal media, cell envelope integrity, and exopolysaccharide production, while overexpression in a chvI K214T background is toxic to the bacteria and causes a dramatic growth defect. Conversely, overexpression of smc02832 in WT or in chvI K214T does not affect any of the tested phenotypes. Our results indicate that overexpression of a gene involved in capsular polysaccharide synthesis, smb20809, also affects other phenotypes of the free-living bacteria such as exopolysaccharide production and cell envelope integrity.
Funding for this project was provided by NSF grant IOS-0818981 to E.J.C.
Poster #: 222
Project Title: Genetic mapping of hybrid developmental delay with novel near-isogenic lines of Caenorhabditis briggsae
Author List:
Montgomery, Jordan; Graduate, Biology, California State University, Fresno, Presenting Author
Ross, Joseph; Faculty, Biology, California State University, Fresno
Abstract: Speciation events occur when two organisms are able to reproduce but their hybrid offspring are unfit, which can be a result of genetic incompatibility between the parental species. Classical approaches to studying the genetic interactions underlying most instances of speciation prove difficult as a result of hybrids being inviable or sterile. C. briggsae is a suitable model system for such speciation studies because of its unique and distinct phylogeographic populations and its ability to produce fertile inter-population hybrid offspring that are measurably less fit than their parents. 20% of temperate strain HK104 and tropical strain AF16 hybrid offspring exhibit a developmental delay phenotype in the F2 generation: they take about 33% longer than a normal worm to reach adulthood. This phenotype is associated with homozygosity of AF16 alleles near the middle of chromosome III; the underlying genetic incompatibility might represent the onset of speciation in C. briggsae. To genetically map the chromosome III locus involved in producing hybrid developmental delay, 21 near-isogenic lines (NILs) were created using a GFP selectable marker near the middle of chromosome III. Lines are expected to be completely homozygous for HK104 alleles except for an introgressed region of AF16 on chromosome III surrounding the GFP gene. These lines were phenotyped for developmental delay by crossing each to an F1 hybrid to detect the presence of delay in F2 offspring. Then, PCR genotyping was performed with primers specific to chromosome III to identify the boundaries of the AF16 introgressed regions and to narrow down the chromosome III location associated with the developmental delay phenotype. 10 NILs have been genotyped and phenotyped, with all producing delayed offspring. These data narrow down the responsible locus to an approximately 3.5 Mbp region. Results for 11 additional NILs will also be described. We expect that a portion of these NILs will not produce delayed offspring. Their genotypes will be compared to those exhibiting delay to determine the responsible locus. Identification of the developmental delay locus will assist in better understanding the evolutionary forces and genetic mechanisms driving speciation events.
Poster #: 223
Project Title: Genetic mapping of developmental delay phenotype in Caenorhabditis briggsae tropical x temperate hybrids
Author List:
Velazco-Cruz, Leonardo; Undergraduate, Biology, California State University, Fresno, Presenting Author
Ross, Joseph; Faculty, Biology, California State University, Fresno
Abstract: Populations of the nematode Caenorhabditis briggsae show great genetic variation between geographical locations, making them well suited for speciation studies. Biological species are defined as populations whose hybrids have zero fitness. Previous experiments have shown a reduction in fitness exhibited by a developmental delay in F2 hybrids of tropical (AF16) and temperate (HK104) strains. The developmental delay phenotype present in C. briggsae F2 hybrids signals the onset of speciation between temperate and tropical strains. AF16 homozygosity at an unknown locus in the middle of chromosome III has been associated with this developmental delay phenotype. I hypothesize that the developmental delay phenotype in F2 hybrids is caused by a locus on chromosome III that is homozygous for the AF16 allele. To begin the identification of the genetic variant on chromosome III that produces hybrid developmental delay, I am performing genetic mapping of the delay phenotype using polymerase chain reaction genotyping. Preliminary results show 15% occurrence of F2 hybrid delay and a perfect association between locus cb-m205 and the developmental delay phenotype. These results suggest that the frequency of developmental delay in F2 hybrids is not a simple Mendelian trait and that the developmental delay locus is near cb-m205. Future efforts will involve genotyping loci across chromosome III to identify recombination breakpoints in F2 hybrids and narrow down the locus where genes implicated with developmental delay are found. By finding the genes significant to the onset of speciation, a better understanding of the process of allopatric speciation and evolution can be obtained.
Poster #: 224
Project Title: Understanding the role of miR-206 during myogenesis in Xenopus laevis
Author List:
Wright, Jeanette; Undergraduate, Biology, San Francisco State University, Presenting Author
Ramirez, julio; Postdoc, Biology, San Francisco State University
Domingo, Carmen; Faculty, Biology, San Francisco State University
Abstract: MicroRNA’s (miRNA) are small non-coding sequences of RNA involved in post-transcriptional regulation of genes. MiRNA’s have been identified in several muscular diseases such as muscular dystrophy, an incurable group of inherited disorders that involve weakness and loss of muscle tissue, which worsens over time. miR-206 is a muscle-specific microRNA that is exclusively found in vertebrates but its role in muscle formation and differentiation is yet to be characterized in vivo. Recent work in our laboratory suggests that knockdown of miR-206, using a morpholino approach in the frog, Xenopus laevis, results in a phenotype that shows major disruptions in somite segmentation with a loss of an ability to remain attached to the notochord,. The muscle fibers that form are misaligned and disorganized. In vitro studies suggest that miR-206 promotes skeletal muscle formation by down regulating genes associated with proliferation (Chen et al., 2010). To examine this possibility in-vivo we used a well characterized mitotic activity marker (pH3) to determine if proliferation was affected by changes in miR-206 levels. We hypothesized that knockdown of miR-206 levels by morpholino injection would lead to an increase in cell proliferation. However, our results suggest that knockdown of miR-206 has no effect on the mitotic activity of the paraxial mesoderm. Interestingly we do detect an increase in cell proliferation among cells positioned next to the myotome, the dermatome. These results suggest that the role of miR-206 in-vivo may be different than what has been observed in-vitro.
Poster #: 225
Project Title: An Exploration of Mitochondrial Dysfunction in Nematodes through Fat Content
Author List:
Chang, Chih-Chiun Jamie; Undergraduate, Biology, California State University, Fresno, Presenting Author
Ross, Joseph; Faculty, Biology, California State University, Fresno
Abstract: Charles Darwin’s concept that a population evolves through variation in reproductive success between its members is explored through two populations of the model organism Caenorhabiditis briggsae. The two populations are HK104, a temperate strain from India, and AF16, a tropical strain from Japan. When mating these two strains, inter-population hybrids show a developmental delay in the second generation. My experiment explores whether hybrid breakdown occurs in the first generation prior to the onset of developmental delay. Additionally, I am also studying the fitness of mitochondria-nuclear hybrids, which are nematodes with AF16 nuclear genome paired with HK104 mitochondrial genome and vice versa. This project seeks to explain whether these two types of hybrids show a decrease or increase in fitness when compared to the pure strains, HK104 and AF16. One way to estimate fitness is to measure the amount of fat in nematodes through Nile Red staining. The motivation for studying fat levels is that a dysfunction in the interaction of mitochondrial and nuclear genomes could cause malfunctions in electron transport systems. The hypothesis is that hybrids nematodes would have lower fat content after burning more fat for energy to compensate for faulty metabolic functions. The underlying question is whether lower fat content represents an underlying defect caused by mitochondria-nuclear genetic interactions. This viewpoint shines light upon the early processes of species formation. To administer the Nile Red stain, nematodes are suspended in a liquid dye solution that stains fat compartments. Fluorescence given off by the dye is quantified by the program ImageJ while subtracting any autofluorescence given off by control worms that did not ingest the stain. The fluorescence given off by inter-population and mitochondria-nuclear hybrids are analyzed in comparison to the pure strains. Three experiments were conducted to measure fat content in cases of whole body and localized fluorescence. Whole body fluorescence was used to stain the entire alimentary canal, while localized fluorescence targeted the feeding machinery region and acted as a control for worm length. In both cases, inter-population hybrid worms had statistically higher fat content than pure strains. It was fascinating to see that the results were opposite of what was expected in our hypothesis. Ongoing experiments are being performed to determine if mitochondria-nuclear hybrids show the same pattern.
Poster #: 226
Project Title: Spontaneous bacterial multidrug resistance through an efflux pump regulator mutation
Author List:
Arvizu, Ignacio; Undergraduate, Biology, California State University, Northridge, Presenting Author, Nagel Award Finalist
Wolman, Ram; Undergraduate, Biology, California State University, Northridge
Murray, Sean; Faculty, Biology, California State University, Northridge
Abstract: Fatty acid biosynthesis is inhibited by the antibiotic cerulenin. In Caulobacter crescentus, obstruction of fatty acid biosynthesis has been linked with many cell cycle regulated events. A previous study showed that cerulenin’s activity in Pseudomonas aeruginosa can be prevented by export of the antibiotic from the cell via an efflux pump. In this study, we identified a spontaneous cerulenin-resistant C. crescentus mutant with a truncated TetR repressor-like protein called TipR. TipR has been shown to regulate the expression of an efflux pump operon encoded by the genes CC_0808, CC_0807, and CC_0806. We found that truncated TipR in our cerulenin-resistant mutant yields increased expression of the efflux pump operon. Additionally, the cerulenin-resistant mutant was found to be resistant to multiple antibiotics. A tipR knockout strain produced a similar phenotype, which can be suppressed by a loss-of-function mutation in the CC_0807 efflux pump gene. As expected, deleting the efflux pump in the cerulenin-resistant mutant restored sensitivity to cerulenin as well as other antibiotics. Ultimately, this confirmed our hypothesis that both cerulenin and multidrug resistance in this strain of C. crescentus was achieved by the activity of the efflux pump coupled with truncation of the TetR repressor-like protein.
This work was supported by NIH grant SC2 GM084860 to SRM and NIH R25 GM063787 to MariaElena Zavala in support of IA.
Poster #: 227
Project Title: Developmental Ethanol Exposure Alters Feeding Behavior in Drosophila melanogaster.
Author List:
Guevara, Amanda; Graduate, Biological Sciences, San José State University, Presenting Author
Duenas, Annalisa; Undergraduate, Biological Sciences, San José State University, Presenting Author
French, Rachael; Faculty, Biological Sciences, San José State University
Abstract: Fetal Alcohol Spectrum Disorder (FASD) describes a collection of physical and neurobehavioral disabilities resulting from developmental alcohol exposure (DAE). In both flies and mammals, DAE can cause a variety of phenotypes including growth and developmental delays, learning and memory deficits, physical disabilities and morphological changes, and a variety of neurobehavioral changes including feeding abnormalities and sleep disorders. However, despite four decades of research into the effects of ethanol exposure on development, the molecular and neurological pathways underlying phenotypes are largely uncharacterized. In addition, public health campaigns to reduce drinking during pregnancy have shown limited success, and the rates of both prenatal drinking and fetal ethanol effects have been unchanged for the past 15 years. Thus, a better understanding of the mechanisms underlying the deleterious effects of ethanol on development are critical for the development of treatments to mitigate the effects of the disorder(s).
Children with FASD often show feeding difficulties, which arise from both physical disabilities and neurobehavioral changes. We have established a Drosophila model of FASD, and have used it to test the feeding behavior of ethanol-reared flies. Flies are placed in media containing blue food dye, allowed to eat for different lengths of time (depending on the experiment), and then the amount of food consumed is determined using visual analysis and spectrophotometry. Our data show a complex and interesting pattern of behavior in ethanol-reared flies. Flies reared in ethanol are more motivated to eat (a higher fraction of the flies consume food) after a period of starvation (18 hours) than control animals, but their meal size is significantly smaller. Conversely, ethanol-reared but unstarved flies show more feeding motivation than unstarved control flies.
Neuropeptide F (NPF; NPY in mammals) regulates a variety of reward pathways, including food, sex, and drug reward. We are currently examining the expression of NPF in the brains of ethanol-reared flies in order to determine the effect of DAE on the activity of this reward pathway. In addition, we are conducting behavioral genetic experiments to determine whether manipulation of the levels of NPF can rescue the effects of larval ethanol exposure on feeding behavior. This research was supported by a grant from the NIH National Institute of General Medical Sciences (5SC3GM103739).
Poster #: 228
Project Title: REGULATION OF CARBOHYDRATE METABOLISM BY ANTIAPOPTOTIC BCL-2 FAMILY PROTEINS: A TRANSCRIPTOMICS APPROACH
Author List:
Mahmood, Bushra ; Graduate, Chemistry, California State University, Fresno, Presenting Author
Dejean, Laurent; Faculty, Chemistry, California State University, Fresno
Abstract: Cancer cells have shown to exhibit a shift in carbohydrate metabolism in comparison to normal cells. This shift is likely due to enhanced transcription of genes involved in regulating glycolysis. In lymphomas, there is also a shift in carbohydrate metabolism but very little is known about what causes this effect. Bcl-2 family proteins regulate apoptosis in cells. Bcl-2 and Bcl-xL are anti-apoptotic proteins from the Bcl-2 family which high expression levels are associated with certain blood cancers such as Non-Hodgkin’s Lymphoma. Also, recent findings indicate a regulatory link between Bcl-2 family proteins and carbohydrate metabolism; a link which could be directly affected by high expression levels of Bcl-2 and/or Bcl-xL. Using RT² Profiler™ PCR Array for Mouse Glucose Metabolism, expression level of 84 critical genes which are involved in the various enzyme pathways and regulation of carbohydrate metabolism were analyzed for mice pre-lymphocytes which were either over expressing Bcl-2 or Bcl-xL. Both over expression phenotypes are associated with a favored up-regulation of the expression of genes encoding for glycolytic enzymes. This observation, coupled with that that the total amount of LDH subunits are increased in both Bcl-2- and Bcl-xL-overexpressing cells, indicate a potential shift of the metabolism of these 2 cell lines towards a higher degree of lactic fermentation. Also, our results indicate a gene of interest, PYGL, which encodes for the enzyme glycogen phosphorylase, is differentially regulated in the two cell lines compared to the wild type. PYGL is upregulated in Bcl-2 over expressing cells and down regulated in Bcl-xL over expressing cells. This result suggests that Bcl-2-overexpressing cells rely more on glucose units coming from glycogen degradation than that coming directly from extracellular glucose; and that the opposite is true of Bcl-xL overexpressing cells. Taken together, these data suggest that Bcl-2 and Bcl-xL play an important role in the regulation of glycolysis and glycogen metabolism; and that a high abundance of these proto-oncogenes may directly favor metabolic shifts involving higher lactate production rates such as those encountered in certain cancer cells.
Poster #: 229
Project Title: Assessing the Role of Autotransporter Esterase EstA of Pseudomonas aeruginosa in Susceptibility to Host-Derived Antimicrobial Cholesteryl Esters
Author List:
Jacobo, Christina; Graduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Porter, Edith; Faculty, Biological Sciences, California State University, Los Angeles
Abstract: Pseudomonas aeruginosa is an opportunistic, Gram-negative bacterium and a major cause of health care associated infections. Previous studies have shown that epithelial cell-derived cholesteryl esters (CEs), including cholesteryl linoleate (CL) and cholesteryl arachidonate (CA), exhibit antimicrobial activity against some strains of P. aeruginosa. P. aeruginosa carries an outer membrane-bound esterase, EstA, which has been shown to be important for bacterial biofilm formation. We hypothesize that EstA also functions as a virulence factor, inactivating host-derived antimicrobial cholesteryl esters and that EstA levels are reduced in CE sensitive strains compared to CE resistant strains. To test this hypothesis we designed four different estA primers and primers for four different housekeeping genes (acpP [acyl carrier protein], gyrB [gyrase], proC [constitutive delta 1-pyrroline 5-carboxylate reductase], and 16SrRNA). We then optimized PCR conditions with a P. aeruginosa strain shown previously to be resistant against CL and CA (PACE-R) and a CE sensitive strain (PACE-S). Based on threshold cycle time (CT), melt curve analysis, and ethidium bromide stained agarose gel electrophoresis, we have found acpP gene to be the best housekeeping gene for our strains, showing a CT value between 20 and 25, a melt curve peak at 85 °C, and a clean product of the expected size of 80 bp without primer dimers or amplification of the no-cDNA control sample. Two of the estA primers had CT values similar to acpP, produced clean melting curves with peaks at 84°C and 88°C, and specific products of the expected size of 107 and 153 bp, respectively. We have begun to test estA gene expression in the PACE-R and PACE-S and pilot data suggests a reduced estA gene expression (about 50%) in PACE-S compared to PACE-R. Our next steps include determining the primer efficiency, sequencing the PCR products and quantifying estA gene expression in the presence and absence of antimicrobial cholesteryl esters with the above tested strains and an EstA knock-out strain. This research may lead to the identification of EstA as a novel virulence factor and may lead to new therapeutic approaches against P. aeruginosa targeting estA gene expression or EstA activity. This work was supported by NIH for Grant 1SC1 GM096916 (to EP), NIH MBRS RISE MS- to- PhD program grant R25 GM61331.
Poster #: 230
Project Title: Constructing Luciferase Reporter Plasmids to Test for Combinatorial Role of MyoD in the 5’ and 3’ Regulatory Regions of Acta1 Gene Expression
Author List:
Esaian, Sevan; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Gonsalez, Carla M; Undergraduate, Biological Sciences, California State University, Los Angeles, Presenting Author
Vu, Ha V; Undergraduate, Biological Sciences, California State University, Los Angeles
DeSalvo, Gilberto; Division of Biology and Biological Engineering, Caltech, Pasadena, CA
Wold, Barbara J; Division of Biology and Biological Engineering, Caltech, Pasadena, CA
Sharp, Sandra B; Faculty, Biological Sciences, California State University, Los Angeles
Abstract: Myogenesis is the process by which pre-muscle cells (myoblasts) differentiate into mature muscle tissue. The myogenesis regulatory factor (MRF) family comprises a key group of four transcription factors responsible for regulating muscular development. MyoD is one of these MRFs. Members of the MRF family are basic helix-loop-helix proteins, which dimerize and bind to a DNA E-box sequence (CANNTG) to regulate transcription within pre-muscle and muscle cells. One of the genes regulated by MyoD is the Acta1 gene, which codes for skeletal muscle actin and is induced to express skeletal muscle actin mRNA during the later stages of myogenesis. Chromatin immunoprecipitation followed by sequencing has shown that MyoD is bound both upstream and downstream of the Acta1 transcribed region. We hypothesize that the 5’ and 3’ regions of MyoD binding participate in a combinatorial activation of Acta1 gene transcription. To test this hypothesis, we have used standard recombinant DNA and sequencing techniques to make and verify luciferase reporter plasmid constructs with mouse 5’ and 3’ regulatory regions inserted upstream and downstream, respectively, of the luciferase reporter gene. We have used site directed mutagenesis to prevent MyoD binding to a critical E-box in the 5’ regulatory region and are currently working to insert the downstream regulatory regions into the mutated version of the plasmid. Transient transfection into C2C12 myogenic cells and dual luciferase assay has shown that the Acta1 5’ regulatory region drives luciferase expression in the absence of 3’ regions, and supports upregulation of expression when cells are induced to differentiate. To test for combinatorial activation, the luciferase production from constructs with and without 3’ regions will be compared. If our hypothesis is correct, we anticipate that luciferase expression will increase in the presence of the 3’ region. To our knowledge, this is the first time a putative combinatorial transcriptional regulatory action between MyoD binding regions located 5’ and 3’ of a muscle-specific gene will have been tested. A demonstration of combinatorial regulation at the Acta1 gene will raise the possibility that other muscle-specific genes are regulated by MyoD binding regions at inter-gene locations other than 5’ of the transcribed region. Work funded by CSUPERB and National Institute of General Medical Sciences through TWD RISE award R25 GM061331.
Poster #: 231
Project Title: Developmental Ethanol Exposure Disrupts Wingless/Wnt Signal Transduction in Drosophila melanogaster.
Author List:
Lopez, Sabrina; Undergraduate, Biological Sciences, San José State University, Presenting Author
French, Rachael ; Faculty, Biological Sciences, San José State University
Abstract: Developmental exposure to alcohol in both mammals and flies leads to a variety of developmental and neurobehavioral defects, including reduced brain size (due to ethanol-induced cell death),reduced survival, growth and developmental delays, and mental retardation. Collectively, these effects are known as Fetal Alcohol Syndrome (FAS) or Fetal Alcohol Effects (FAE) In our lab, we use Drosophila as a genetic model for FAS, in order to identify the molecular genetic targets of developmental ethanol exposure. In this poster, we present data indicating that glycogen synthase kinase 3β (GSK-3β) exerts a protective effect against the deleterious effects of developmental alcohol exposure (DAE), and that DAE results in reduced Wnt/Wingless signal transduction .
GSK-3β is a multifunctional protein that mediates signaling through a multitude of pathways, including the Wingless/Wnt signal transduction pathway and the insulin-signaling pathway, both of which we have shown to be affected by DAE. Adult flies mutant for the Drosophila homolog of GSK-3β (shaggy, sgg) display a variety of ethanol-related phenotypes, including reduced habituation to the odor of ethanol, increased ethanol-induced locomotor hyperactivation, and resistance to ethanol-induced programmed cell death (French and Heberlein, 2009; Wolf et al., 2007) We show here that sgg mutant flies display nearly complete lethality when exposed to ethanol during development. Similarly, we show that mutations in components of one of the Drosophila Wnt signal transductions pathways lead to increase DAE-induced lethality. Finally, we show that developmental exposure to ethanol results in reduced expression of shaggy mRNA, as well as altered expression of other gene expressing components of the Wingless/Wnt signal transduction pathway.
Poster #: 232
Project Title: Behavioral assays to study deficits in spatial cognition in Drosophila melanogaster.
Author List:
Aparicio Valenzuela, Joy; Undergraduate, Biology, California State University, Fresno, Presenting Author, Nagel Award Finalist
Lent, David; Faculty, Biology, California State University, Fresno
Abstract: The fruit fly, Drosophila melanogaster, has proven to be a useful model organism in the study of many human disease processes. The fruit fly has become a commonplace in both genetic experiments and neurobiological experiments. Nearly 70% of disease-associated human genes have a fly homolog or transgenic model, which makes neurodegenerative disease research with this organism very feasible. While many neurobiological aspects of disease have been studied in fruit flies, there is yet no solid measure of complex behavior associated with neurodegenerative diseases. Often we can only use basic measures to view decline in behavior and a quantitative measure of cognition in fruit flies is lacking. Most insects, including fruit flies, have very good learning abilities and lend themselves well to behavioral studies. Experiments here quantified the behavior of flies in a place learning/spatial memory assay in order to elucidate cognitive traits. Using GAL4-UAS and GAL80 temperature sensitive mutants to express disease-associated proteins (e.g. Tau & ABeta42) in specific brain regions allowed for the study of aspects of spatial cognition and cognitive decline in fruit flies. Training flies in a place memory assay provided insight into issues of visual perception, visual learning and short-term memory. The use of long-term probe trials provided better understanding of processes of consolidation and long-term memory. This assay demonstrates variable rates of learning, variable disruption in short-term and long-term memory. These differences were attributed to differential expression of the ectopic proteins in the mushroom bodies and central complex of the flies. These brain regions were found to be individually important in certain elements of perception and learning. However, only when both regions were functionally intact was more complex spatial cognition revealed. This is one of the first studies to focus on cognitive decline in Drosophila. This has significance in that it relates to the overexpression or misregulation of proteins that cause neurodegeneration and dementia. By learning more about the molecular pathways and the quantitative expression levels of disease associated proteins in the nervous tissue of fruit flies and correlating that with a quantitative measure of spatial cognition, we can further enhance our understanding of neurodegenerative diseases in humans.
Poster #: 233
Project Title: Contribution of Snail1 to the pathogenesis of bacterial meningitis
Author List:
Kim, Brandon; Graduate, Biology, San Diego State University, Presenting Author
Smurthwaite, Cameron; Graduate, Biology, San Diego State University
Wolkowicz, Roland; Faculty, Biology, San Diego State University
Doran, Kelly; Faculty, Biology, San Diego State University
Abstract: Bacterial meningitis is the most common serious infection of the central nervous system (CNS). Severity of this infection is accented by a 5-10% mortality rate in patients despite an early diagnosis and treatment with antibiotics, with permanent neurological damage in up to 20% of survivors. To cause meningitis, blood borne bacteria must in some way penetrate the blood brain barrier (BBB) which is a single layer of specialized brain microvascular endothelial cells (BMEC) that act to separate the blood from the CNS while also mediating transport of molecules required to maintaining proper brain function. The cells of the BBB are bound together with tight junctions that also function to maintain proper barrier function. By utilizing our in vitro model of the BBB we found that infection with the meningeal pathogen Group B Streptococcus (GBS) disrupts tight junction formation, specifically inhibiting transcription and protein production of tight junctional proteins ZO-1, Claudin-5 and Occludin. Interestingly, we observed that GBS and other bacterial pathogens associated with meningitis, are able to induce Snail1, a global transcriptional repressor of tight junction proteins. GBS infection resulted in a significant increase in snail1 transcript in vitro and in vivo using a murine model of disease. We further show by overexpression and shRNA knockdown of Snail1 that this factor is both necessary and sufficient for tight junction disruption during bacterial infection in vitro. As Snail1 is embryonic lethal in vertebrate models, we therefore sought to generate an inducible dominant-negative Snail1 construct for use in a zebrafish model of GBS infection. We have engineered transgenic zebrafish that expresses a truncated form of Snail1 that is under control of a heat shock promoter. Preliminary results suggest that critical tight junction proteins are upregulated upon inhibition of Snail1. These transgenic fish will now be utilized to examine the role of Snail1 in vivo during GBS infection. These findings highlight a novel mechanism of BBB disruption during the pathogenesis of bacterial meningitis. Future studies seek to continue to examine the role of Snail1 as this factor has never been studied in the context of BBB disruption during infectious disease.
Poster #: 234
Project Title: Functional Characterization of Folate Biosynthesis Pathway in Rickettsia Species Phylotype G021 Through Complementation of Folate-Auxotrophic E. coli
Author List:
Teague, Kristine; Graduate, Biological Sciences, Humboldt State University, Presenting Author
Delaunay-Vandal, Misha; Undergraduate, Biological Sciences, Humboldt State University
Moser, Shannon; Undergraduate, Biological Sciences, Humboldt State University
Jones, John; Undergraduate, Biological Sciences, Humboldt State University
Mori, Hirotada; Nara Institute of Science and Technology
Zhong, Jianmin; Faculty, Biological Sciences, Humboldt State University
Abstract: We are studying the bacterial endosymbiont, Rickettsia species phylotype G021, in western black-legged ticks (Ixodes pacificus). It is believed this relationship is mutually beneficial, with shelter provided for Rickettsia and augmentation of tick folate levels with rickettsial folate. The overall goal of the project is to functionally characterize the folate biosynthesis pathway through complementation of E. coli folate mutants.
In order to perform the complementation assay, we amplified folate genes of Rickettsia from Ixodes pacificus, using polymerase chain reaction (PCR) amplification, and cloned them into the pSC-A-amp/kan plasmid, from the StrataClone PCR Cloning kit. We created primers for each gene using annotated gene sequences produced previously in our lab, and included the appropriate restriction sites in order to sub-clone these genes into the TransBac vector, a plasmid containing a lac promoter that controls the folate gene expression in the complementation assay. Thus far, we have amplified folKP, folA, folC, ptpS, and a negative control, gltA.
To facilitate later steps of the complementation assay, we plated the bacteria on LB agar and M9 minimal agar to confirm E. coli deletion mutation for each folate gene (folA, folB, folC, folE, and folK) and demonstrated varying levels of auxotrophy, depending on the specific gene deletion and the media used. A large amount of growth was seen on plates containing the IPTG inducer, compared to plates lacking the inducer, suggesting that the folate gene expression supports growth of folate deletion mutants and that there are other ways to support growth, possibly salvage pathways for amino acids and nucleotides which require products of the folate biosynthesis pathway. Originally, the mutants were grown on LB agar and we hypothesized that growth on plates lacking inducer, was due to the nutrients inherent to the LB medium. However, growth was still seen on M9 minimal agar lacking IPTG or any other additional nutrients. This growth was less robust than on LB plates, indicating the nutrients of the LB agar were an aiding factor of growth. Since M9 agar will have less of an effect on E. coli growth due to limited nutrients, using it will make complementation results more accurate.
We’d like to extend a special thank you to Dr. Hirotada Mori for all his generosity of time in supplying mutant E. coli and advice. This research is funded by NIH grant 1R15AI82515-01.
Poster #: 235
Project Title: Identification and Expression of Genes Involved in Iron Homeostasis in Methylobacterium extorquens AM1
Author List:
Resnik, Mayra; Undergraduate, Biological Sciences, San José State University, Presenting Author
Camacho, Beatriz; Undergraduate, Biological Sciences, San José State University
Skovran, Elizabeth; Faculty, Biological Sciences, San José State University
Abstract: Iron is essential for most living organisms, however, too much iron can cause oxidative damage. Cells have evolved to tightly regulate iron uptake in order to maintain homeostasis. Methylobacterium extorquens is a model organism for the understanding of methylotrophic growth and is of interest as a platform for producing biofuels and biodegradable plastics from methanol. Previous microarray experiments showed that iron uptake was differentially regulated between single- and multi-carbon growth and that the methylotrophic carbon assimilation regulator, QscR, may coordinate this response. To assess the role of QscR in iron regulation, QscR was purified and direct binding to iron uptake promoter regions was assessed. In addition to QscR, the M. extorquens genome revealed candidates for FecI and FecR, regulators involved in ferric citrate uptake, and Irr, a putative heme uptake regulator. Null mutations in each of these regulators were generated and growth under iron limitation and iron excess was assessed. The qscR and irr mutant strains grew better than the wild type strain under iron limiting conditions consistent with these regulators functioning as repressors of iron uptake genes. Loss of fecI resulted in growth inhibition under limiting iron conditions consistent with a role of FecI in activation of iron uptake. To assess regulation in vivo, promoter fusion constructs were generated by fusing the promoter regions of eleven putative iron uptake and iron storage genes to the fluorescent reporter, Venus. Initial results demonstrated that at least four of the regions tested are differentially regulated by iron. Future work will determine the relationship between the different iron regulators and the genes involved in iron uptake and storage.
Poster #: 236
Project Title: Molecular and Genetic Screens Identify Genes Required for Developmental Ethanol Response in Drosophila
Author List:
Wu, Jodie; Undergraduate, Biological Sciences, San José State University, Presenting Author
Lafler, Janet; Graduate, Biological Sciences, San José State University
French, Rachael; Faculty, Biological Sciences, San José State University
Abstract: Fetal Alcohol Spectrum Disorder (FASD) describes a collection of physical and neurobehavioral disabilities brought on by maternal alcohol consumption during pregnancy. While it has been clear for over two decades that genetic factors are involved in the susceptibility to, and severity of, FASD, no genes mediating these effects in mammals have been identified. In addition, very little is known about the targets of ethanol during development, in flies or mammals. Drosophila larvae reared in ethanol mirror the detrimental effects of FASD; we are therefore using flies as a genetic model to identify developmental ethanol targets. In order to identify the genes involved in larval response to ethanol exposure in an unbiased fashion, we carried out two complementary screens. First, we generated approximately 1000 novel transposon-induced mutations and screened them for altered survival and development time when reared in ethanol. We have generated 30 new mutations, most of which are in genes previously unknown to be affected by (or to affect the results of) developmental alcohol exposure. Second, we carried out a microarray analysis to identify transcripts whose expression was altered in ethanol-reared 3rd instar larvae. Among the mutations we identified two alleles of withered (whd), the Drosophila homolog of carnitine palmitoyltransferase I (CPT1). These alleles are sensitive to the effects of ethanol, as are several previously existing alleles of whd. Additional mutations, including one in the Drosophila carnitine transferase (CT) gene, are also predicted to disrupt fatty acid metabolism, leading us to propose disrupted fatty acid metabolism as a potential mechanism for ethanol-induced developmental damage. This is an exciting finding, because several human developmental disorders, including Tay-Sachs disease and Niemann-Pick Disease, result from abnormal lipid metabolism. This presents the exciting possibility that some aspects of FASD may be treatable or preventable through simple dietary changes. We will present the findings of both screens and our plans for future characterization of the genes identified. This research was supported by a grant from the NIH National Institute of General Medical Sciences (5SC3GM103739) and a 2014 Howell-CSUPERB Research Scholar Award.
Poster #: 237
Project Title: Ciglitazone and Lovastatin Regulate Genes Involved in Glucose Metabolism in HepG2 Cells
Author List:
Korsakova, Elena; Graduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Medh, Jheem; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Background: Insulin resistance and dyslipidemia are related metabolic disorders. In liver cells, insulin resistance is characterized by a decrease in glucose uptake, oxidation, and storage; and an increase in gluconeogenesis and glycogen breakdown. Thiazolidinediones (TZDs) are synthetic insulin-sensitizing agents used to treat insulin resistance. TZDs activate PPAR-gamma, a member of the nuclear receptor family of transcription factors, to exert a wide range of plasma glucose-lowering strategies, including reduced hepatic glucose production and increased glucose storage as glycogen. TZDs also improve the plasma lipid profile. Statins are cholesterol lowering drugs that inhibit hepatic production of cholesterol. A few studies have demonstrated that statins also improve insulin resistance and glucose metabolism. Our objective was to determine if Ciglitazone, a TZD, and Lovastatin, a statin, regulate specific genes involved in glucose metabolism in liver cells.
Objective: The effect of Lovastatin and Ciglitazone on the regulation of genes for the gluconeogenesis pathway, phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6PC) was determined. In addition, the regulation of genes for glycogen synthase kinase 3β (GSK3B), a negative regulator of glycogen synthesis, and Phosphatidylinositol-4,5-bisphosphate 3-kinase beta (PIK3R2), a key intermediate in the insulin signaling pathway was also investigated in HepG2 cells.
Methods: Cells were treated with 4 to 10 μg/mL of Lovastatin or 1 to 5 mM of Ciglitazone. Total RNA was isolated using TRI reagent, and quantified by spectrophotometry. Next, gene-specific primer pairs were used to perform end-point and real-time RT-PCR. The intensity of the amplicons determined by ImageJ analysis (end-point PCR) or the CT values (real-time PCR) were corrected for the house-keeping gene HMBS to compare mRNA levels. Protein levels of the gene products were compared by Western Blot analysis.
Results: Our data indicate that Lovastatin up-regulates the expression of PEPCK and GSK3B genes, but down-regulates PIK3R1. Treatment with Ciglitazone up-regulates GSK3B and down-regulates G6PC.
Conclusion: Lovastatin and Ciglitazone both regulate glucose metabolism in the liver with some overlapping functions. This may have implications for patients prescribed both medications.
Acknowledgements: This work was supported by National Institutes of Health Award SC3GM095413.
Poster #: 238
Project Title: Species and Subspecies Typing of Ixodes pacificus Rickettsial Endosymbiont (REIP) Isolated from Ovaries of Engorged Ixodes pacificus
Author List:
Alowaysi, Maryam; Graduate, Biology, Humboldt State University, Presenting Author
Chen, Junyan; Undergraduate, Biology, Humboldt State University, Presenting Author
Zhong, Jianmin; Faculty, Biological Sciences, Humboldt State University
Abstract: Bacterial endosymbionts often contribute to the nutritional fitness of their hosts, as seen with Buchnera endosymbionts in aphids. Using in vitro culture system, Ixodes scapularis (ISE6) cell lines infected with an isolate of Ixodes pacificus rickettsial endosymbiont (REIP) was used to investigate vitamin B9 (folate) biosynthesis by the endosymbiont. Previous research in our laboratory has detected Rickettsia species phylotype G021 that is 100% transovarially and transstadially transmitted in Ixodes pacificus. MUMmer genome alignment of whole genome sequence of Ixodes scapularis (the closest relative to I. pacificus) and metabolic pathway reconstructions indicated that Rickettsia species phylotype G021 has the ability to produce folate de novo. An isolate of REIP was obtained from ovaries of engorged I. pacificus. To study biology of the isolate using the in vitro culture system, classification of the REIP isolate into species and subspecies by multilocus sequence typing and multi-spacer typing was carried out. Genes of ompA, gltA, and 16S rRNA, dksA-xerC, mppA-purC, and rpmE-tRNAfMet genes were amplified by PCR, cloned, and sequenced. Sequencing and BLAST analysis showed that the identity of ompA and gltA genes of REIP is 99% to phylotype G021. Moreover, the identity between ompA, gltA, 16S rRNA, dksA-xerC, mppA-purC genes of REIP and I. scapularis endosymbiotic Rickettsia is 99% and the identity between rpmE-tRNAfMet gene of the bacterium and I. scapularis endosymbiotic Rickettsia is 97%. SeaView phylogenetic tree constructions using Neighbor-joining algorithm based on homologous sequences of all six genes of REIP and validated spotted fever group Rickettsia showed that the REIP isolate formed a monophyletic group with Rickettsia species phylotype G021 and I. scapularis endosymbiotic Rickettsia and that the monophyletic group is distinct from the rest of spotted fever group rickettsiae. The REIP isolate from engorged I. pacificus and Rickettsia species phylotype G021 appear to be the same Rickettsia species. Further sequencing analysis of the clones will confirm if a few single-nucleotide polymorphisms exist between the two genotypes. Our classification results will facilitate investigation of folate de novo biosynthesis by REIP using in vitro Rickettsia-infected ISE6.
Poster #: 239
Project Title: SAMPLING AND EXTRACTION METHODOLOGY FOR AERATION DIFFUSER FOULING BIOFILM
Author List:
Asvapathanagul, Pitiporn; Faculty, Civil Engineering and Construction Engineering Management, California State University, Long Beach, Presenting Author
Garrido, Manel; University of California, Irvine
Chen, Deqiang; Hohai University
Olson, Betty; University of California, Irvine
Garcia, William; Undergraduate, Civil Engineering and Construction Engineering Managment, California State University, Long Beach
Rosso, Diego; University of California, Irvine
Abstract: Each nucleic acid protocol yields different amount of DNA and purity, which causes difficulties when data across studies need to be compared. Currently, there is no standardized DNA extraction protocol for diffuser biofilms. The goal of this study is to develop a standard NA extraction protocol for biofilm samples taken from diffusers. Nine and 12-month-old biofilms were collected from 2” EPDM, 2” Silicone, 3” EPDM, Ceramic disc and EPDM disc with mixed liquor (ML) samples. All diffusers were installed in a reactor located at Michelson Water Reclamation Plant, Irvine, CA. Triplicate of 1.00×1.00 cm from three locations on each diffuser were cut and subjected to DNA extraction using a modified bead-beating protocol. Cell lysis was performed five times.
The efficiency of the cell lysis step is crucial for obtaining the highest yield of nucleic acid from samples. For ML extraction, a total of two cell lysis steps are utilized because the yield is approximately 70% of total DNA for mixed liquor (Figure 1). Originally, three cell bead beating steps were performed on all biofilm samples collected from diffusers which had been in operation for nine-month-old. However, the DNA concentrations of all biofilm extracts did not demonstrate the same yield data compared to those of ML samples (data not shown). This illustrates that the biofilm structures have a greater strength, which causes cell lysis difficulty. Thus, an additional two bead-beating steps were included in the 12-month-old biofilm extractions. The results revealed similar data to the DNA concentration of the first three observations within those of nine month old biofilm extracts (Figure 2). The comparison of all combined diffuser membrane biofilm DNA concentrations yielded 52±13%, 71±12% and 85±11% for first two, first three and first four cell lysis steps, respectively (Figure 3).
This study clearly demonstrated that the biofilm cells were difficult to lyze compared to flocs. Although, the biofilms were scraped and vacuum suctioned, the effectiveness of cell lysis using the bead-beating protocol was less than with ML samples as mentioned earlier. This finding verifies that the nucleic extraction from biofilms required a special protocol in order to obtain a representative amount of DNA for further analysis steps.
Poster #: 240
Project Title: Using NMR to probe the dynamics of binding between G alpha(i1) and Regulator of G protein Signaling 4 (RGS4)
Author List:
Brooks, Shayla; Graduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Crowhurst, Karin; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: G proteins are integral to signal transmission; as such, misregulation of G proteins is linked to several neurological diseases. RGS (regulator of G protein signaling) proteins accelerate deactivation of alpha subunits in trimeric G proteins by increasing the native GTPase activity of G alpha. There is evidence that conformational changes occur in both G alpha(i1) and RGS4 upon interaction, but other types of motion have not been explored. Proteins are highly dynamic structures that can experience allosteric effects, conformational changes and various types of internal motions. NMR spectroscopy is the best tool for characterizing these motions at local and global levels. We hypothesize that fast and intermediate timescale motions contribute significantly to RGS4 binding, activity and specificity for G alpha(i1).
The dynamics of G alpha(i1)-bound 15N-labeled RGS4 were explored. 1H-15N correlation NMR experiments comparing apo and G alpha(i1) bound RGS4 showed significant and widespread chemical shift changes. Titration of the RGS4/G alpha(i1) complex with apo RGS4 resulted in a surprisingly large number of chemical shift changes and the appearance of completely new peaks. More peaks appeared in both spectra than could be accounted for with just conformational changes, implying that allosteric effects are involved in G alpha(i1) binding, activity and potentially RGS4 substrate specificity.
In order to further explore these allosteric effects new labeling scheme and relaxation experiments are needed. Side chain methyl groups can serve as reporters of protein flexibility and motion. The large size of the RGS/G alpha complex presents a challenge for study by NMR. In response to this challenge we developed a protocol to prepare a complex in which RGS4 has 13C-labeled methyl groups on Ile, Val, and Leu residues against a 12C/deuterated background, and G alpha(i1) is NMR silent (unlabeled). We are now pursuing chemical shift assignments of those methyl groups as a precursor to relaxation experiments that will probe the flexibility of individual residues, thus reporting on dynamics of key areas in RGS4.
This work has confirmed that small-scale internal motions and changes in protein dynamics contribute to the binding of RGS4 to G alpha(i1). A complete understanding of internal protein motions involved with binding is essential for the design of successful therapeutics for neurological diseases.
The authors acknowledge funding from the NSF (MCB-1158177).
Poster #: 241
Project Title: Disruption of the TRPML1-TMEM163 interaction results in abnormal TMEM163 protein trafficking and intracellular zinc metabolism
Author List:
Silva, Joshua; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author, Nagel Award Finalist
Cuajungco, Math; Faculty, Biological Science, California State University, Fullerton
Abstract: Loss of function mutation in the TRPML1 ion channel protein causes the human lysosomal storage disorder known as Mucolipidosis type IV (MLIV). We found that cells affected by MLIV display significantly higher intracellular zinc levels when exposed to exogenous zinc compared to normal cells; however, the mechanism behind this abnormal zinc accumulation remains unknown. We recently identified a putative zinc transporter called transmembrane-163 protein (TMEM163) as an interacting partner for TRPML1. We hypothesize that TMEM163’s interaction with TRPML1 influences its subcellular localization, since TRPML1 has been previously implicated to play a role in membrane trafficking. We also propose that the interaction between the two proteins modulates intracellular zinc levels. To examine the functional relationship between the two proteins, we created two N-terminus deletion mutants of TMEM163. Co-immunoprecipitation study shows that TRPML1 binding to the deletion mutants is disrupted when compared with wild-type (WT) TMEM163. Preliminary results from cell surface biotinylation study reveal that the plasma membrane (PM) localization of TMEM163 deletion mutants increased upon co-expression of TRPML1 in human embryonic kidney (HEK)-293 cells, while the WT TMEM163 co-expressed with TRPML1 decreased, which suggests that TRPML1 influences the internalization of TMEM163. Spectrofluorometric analysis of HEK-293 cells co-expressing TMEM163 deletion mutants and TRPML1 shows a noticeable increase of intracellular zinc levels compared to control cells that co-express WT TMEM163 and TRPML1. Overall, these data suggest that the loss of TMEM163 protein interaction with TRPML1 results in its abnormal PM localization, which subsequently produces intracellular zinc accumulation due to uncontrolled zinc transport into MLIV cells. Furthermore, our findings show that TRPML1 and TMEM163 proteins potentially play a significant role in regulating intracellular zinc homeostasis. Thus, the knowledge from this study could serve as a framework for preclinical studies using zinc chelators as a potential therapeutic approach to neutralize zinc-induced neurotoxicity that we previously proposed to contribute to progressive neurodegeneration in MLIV disease.
This work was funded by the NIH R15 NS070774 grant and CSUF Intramural Grants Program.
Poster #: 242
Project Title: Analysis of lipid bound conformation and stability of amyloidogenic G26R human apolipoprotein A-I
Author List:
Sundar, Preethi; Graduate, Chemistry, California State University, Sacramento, Presenting Author
Roberts, Linda; Faculty, Chemistry, California State University, Sacramento
Abstract: Cardiovascular disease is a leading cause of death in the U.S. High-density lipoprotein (HDL) prevents CVD by transporting cholesterol to the liver for excretion. The main component of HDL is apolipoprotein A-I (apoA-I), which exists mostly in lipid-bound form in plasma. Mutations in apo A-I cause amyloid fibril formation, resulting in severe diseases such as atherosclerosis. Two such amyloidogenic apoA-I variants, L178H and G26R, have been studied in lipid-free form, but it is not known if the lipid-bound form of these mutants leads to aggregation. We compared the lipid-bound form of amyloidogenic G26R to wild type (WT) apoA-I. The protein conformation and stability of reconstituted HDL (rHDL) containing DMPC and either WT or G26R protein, were analyzed by limited proteolysis and by non-denaturing gradient gel electrophoresis (NDGGE). Overall, the particle size and distribution over time and protease treatment for G26R-rHDL compared to WT-rHDL were very similar, with some minor differences. NDGGE analysis revealed that both G26R and WT initially formed particles with diameters of about 9 nm and 12 nm but less of the 12 nm particle was present in G26R samples. Incubation in the absence of protease led to an increase in the amount of the 12 nm particle in G26R samples. Treatment with chymotrypsin for 5 minutes had little effect on rHDL in samples incubated for 1 day but led to a significant increase in the 12 nm particle at 4 days of incubation for both WT and G26R samples. After 1 hour of digestion, a smaller particle about 8.5 nm was observed in both WT and G26R samples incubated for 4 days. After 24 hours of digestion, the main product at all days of incubation in both G26R and WT samples was an 8 nm particle. SDS-PAGE analysis of the protein revealed a similar size cleavage product, about 3 kDa smaller than intact protein, remaining on the 8 nm particles for both WT and G26R. However, the SDS-PAGE banding pattern produced from digestion of particles at 5 and 60 minutes were distinctly different for G26R vs WT apoA-I. Thus, while proteolysis leads to similar size rHDL for the two proteins, the peptide fragment(s) released during digestion are not the same. The majority of amyloid deposits of apoA-I in vivo consist of amino-terminal proteolytic fragments. Our results represent the first work showing that these fragments may be generated from HDL rather than from lipid-free protein and may inform the design of protease inhibitors to target amyloidosis.
Poster #: 243
Project Title: Oligomeric stathmin dissolves to its monomeric state under high pressure as evidenced by electron paramagnetic resonance spectroscopy
Author List:
Chui, Ashley; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author, Nagel Award Finalist
Chua, Katherina; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton
Abstract: Intrinsically disordered proteins (IDPs) are an interesting class of highly dynamic and biologically important proteins. They lack a native three-dimensional fold but can typically acquire an ordered structure when interacting with a binding partner. Many IDPs have been shown to exist as stable, ordered oligomers or sometimes as unstable, disordered aggregates. Various aggregating IDPs have been shown to be pathogenic and typically result in neurophysiological disorders such as Alzheimer’s and Parkinson’s disease. Therefore, it is important to understand the molecular mechanisms by which these aggregates and oligomers form. Of particular interest to us is stathmin, a regulatory IDP responsible for the disassembly of cytoskeletal microtubules. As a result of this function, stathmin is essential for proper cellular growth and function, namely in the coordination of the cell cycle. Improper regulation of stathmin results in the detrimental proliferation of cells that is representative of cancer. It is therefore important to study the solution-phase structure and conformational dynamics of stathmin, as it likely emulates the protein’s native state in the cell. Our preliminary native gel electrophoresis and dynamic light scattering data suggest that stathmin exists as an oligomer or an ensemble of oligomers in solution, which contradicts previous reports of a monomer by analytical ultracentrifugation. To investigate this further, we performed site-directed spin labeling (SDSL) high pressure (HP) electron paramagnetic resonance (EPR) spectroscopy on various singly-labeled stathmin mutants in both buffer and 30% sucrose. Interestingly, the resulting EPR spectra exhibit a general trend of increased peak intensity, attributed to a gain in mobility and a loss of dipolar broadening. This change in exhibited dynamics likely implies that stathmin oligomers are dissolving into monomers. To this end, these data further support our hypothesis that stathmin exists as an oligomer in solution and, as high pressure is applied to the system, it drives a shift in equilibrium towards the monomeric state. These results have implications on how stathmin, as an oligomer, exists natively in the cell and functions as a regulatory protein. More importantly, this study helps to shed light on the general oligomerization behavior of IDPs that are responsible for neurodegenerative diseases.
Poster #: 244
Project Title: Regulation of Lysyl Oxidase
Author List:
Gonzalez, Jesica; Undergraduate, Department of Chemistry and Biochemistry, California State University, Bakersfield, Presenting Author
Lopez, Karlo; Faculty, Department of Chemistry and Biochemistry, California State University, Bakersfield
Abstract: The extra-cellular matrix (ECM) enzyme lysyl oxidase is a quinoprotein involved primarily in the final crosslinking of soluble ECM precursor molecules such as the elastin precursor, tropoelastin, although it also has other roles in biological systems. In order to carry out its function, lysyl oxidase requires the incorporation of a Cu(II) atom near the active-site as well as the self-processed cofactor lysyl tyrosyl quinone. In order to solubilize lysyl oxidase, 6 M urea is required in the buffer regardless of whether the enzyme is extracted from tissue or overexpressed in vitro in E. coli. The work presented herein explores the use of three solubility tags (Nus-A, Thioredoxin, and Glutathione-S-Transferase) in order to overexpress the enzyme in large yields without the need of urea to (1) evaluate the effect of these tags on enzyme activity, (2) test an array of small molecule inhibitors, and (3) to attempt to grow enzyme crystals for structural characterization. Enzyme purity was verified using SDS-PAGE, yields were quantified using a BCA assay, and activity was verified using an amine oxidase Amplex Red assay (either fluorometric or using absorbance). The data indicate that using thioredoxin as a solubility tag yields the greater amounts of enzyme (7.84 mg/L of culture) than using NUS-A (1.5 mg/L of culture); however, the NUS-A tagged enzyme has greater activity (0.11 U/mg) than the thioredoxin-tagged enzyme (0.032 U/mg). Data for the Glutathione-S-Transferase-tagged enzyme is currently being collected; however it appears that the larger the tag is, the less enzyme that is obtained; however, the activity is higher. All tagged forms of lysyl oxidase incorporate copper to at least 68% which is consistent with published data. Crystal growth screening was attempted for the thioredoxin-tagged enzyme using QIAGEN’s Classics Suite as well as a commercial screening for both the NUS-A-tagged and thioredoxin-tagged enzyme. The well images suggest that the tags are making the enzyme either too soluble so that it does not crystalize (NUS-A) or not soluble enough so that it crashes out (thioredoxin). The Glutathione-S-Transferase enzyme will be sent for screening as soon as possible. Small molecule inhibitors have been synthesized and are currently being tested.
Poster #: 245
Project Title: The activated form of the pro-apoptotic protein Bax can be specifically quantified in biological samples using a conformation-specific ELISA
Author List:
Urtecho, Jean-Baptiste; Graduate, Biology, California State University, Fresno, Presenting Author
Peton, Ashley; Undergraduate, Chemistry, California State University, Fresno, Presenting Author
Llanos, Rhaul; Graduate, Chemistry, California State University, Fresno
Dejean, Laurent; Faculty, Chemistry, California State University, Fresno
Abstract: Apoptosis is the cell’s primary response to stress; it is one of the body’s most important lines of defense against cancer, and dysregulation of it has been implicated in a wide variety of other diseases. This wide-ranging significance means that establishing mechanisms for these regulatory processes would offer insight valuable to a large variety of research fields. The process originates with a stress signal from either inside or outside of the cell, which is received by a family of regulatory proteins known as Bcl-2 family proteins. Reception of this signal results in Bax, a pro-apoptotic member of this family, being transformed from a cytosolic monomer to an activated oligomer within the mitochondrial membrane. These oligomers form mitochondrial channels through which cytochrome c and other effectors leak into the cytoplasm and initiate the mechanisms to induce cell death. These activated Bax oligomers are early markers of apoptosis, and their levels may therefore be used as a diagnostic tool for cancers, neurodegenerative disorders and autoimmune disorders, among other diseases. However, current methods only provide a qualitative or, at best, semi-quantitative detection of activated Bax. Practical diagnostic application necessitates that fully quantitative measures be developed. To this end we are developing an enzyme-linked immunosorbant assay (ELISA) protocol in order to quantitatively assess activated Bax levels in biological samples. This ELISA establishes a basis of comparison using both total Bax antibodies and antibodies specific to the n-terminus exposed in the activated form of Bax, allowing us to assess amount of activated Bax and, by extension, how prone to apoptosis the sample cells are. In this study, we show two proofs of principle of our technique: 1-only a pre-activated form of recombinant Bax, and not its soluble monomeric counterpart, is detected; and 2-protein extracts from HeLa cells dying by apoptosis generate more specific signal than their normal counterpart. We conclude from these observations that our ELISA protocol has proven functional, and have shown the ability to readily distinguish between the activated and non-activated forms of Bax, in both standards and biological samples.
Poster #: 246
Project Title: Influence of Amphiphiles on Fibril Formation in Amyloidogenic G26R Variant of Human Apolipoprotein A-I
Author List:
Ishchuk, Roman; Graduate, Chemistry, California State University, Sacramento, Presenting Author
Roberts, Linda; Faculty, Chemistry, California State University, Sacramento
Abstract: Identification of the environmental factors related to amyloid formation is the key to understanding the mechanisms that lie behind these potentially harmful protein aggregates. Apolipoprotein A-I (apoA-I), the major protein component of HDL, has many cardioprotective properties. However, amyloid variants of this protein cause severe degenerative cardiovascular and other systemic diseases. Over 90% of apoA-I in vivo is bound to lipid yet no systematic investigation of the effect of amphiphiles on amyloid formation has yet been done. To address this gap, we examined the effect of three amphiphiles, each with a different charge, on aggregation of the amyloidgenic G26R apoA-I variant. The detergents used are cholate (negataive charge), dodecyltrimethylammoniumchloride (DTAC, positive charge), and Triton-X-100 (TxT, no charge). Samples were incubated for up to 14 days at 4 degrees C and 37 degrees C at concentrations below and above the critical micelle concentration (CMC) of the detergent. Protein aggregation was assessed by light scattering at 340 nm. In the absence of amphiphiles, light scattering increased throughout the two-week period at both 4 degrees C and 37 degrees C, with a much larger increase occurring at 37 degrees C. All three detergents inhibited aggregation at concentrations above their CMC. DTAC inhibited aggregation at all detergent concentrations. These data form a foundation for exploring factors in preventing aggregation and may suggest treatments for apoA-I based amyloid disease.
Poster #: 247
Project Title: Secondary Structure and Stability of Curli Secretion Proteins CsgE and CsgF, and their interaction with CsgA
Author List:
Patray, Sharon; Undergraduate, Chemistry and Biochemistry, California State University San Marcos, Presenting Author
Rimple, Remington; Undergraduate, Chemistry and Biochemistry, California State University San Marcos, Presenting Author
Jayasinghe, Sajith; Faculty, Chemistry and Biochemistry, California State University San Marcos
Abstract: Background: Curli , a type of proteinaceous cell surface filament, found on enteric bacteria such as E. Coli and Salmonella, are thought to play an important role in host cell adhesion and invasion. Assembly of the major structural protein, CsgA, into curli is aided by three non-structural proteins, CsgE, CsgF, and CsgG. CsgE and CsgF are thought to be periplasmic chaperone proteins that play a vital role in the assembly of Curli fibers. It has been shown that CsgE is able to prevent the aggregation of CsgA into Curli fibers. We sought to determine the secondary structure, and stability of csgE and CsgF, as well as the ability of purified CsgF to prevent the aggregation of CsgA.
Methodology: We expressed C-terminally histidine tagged CsgE and CsgF using the E. Coli BL21(DE3) expression strain, and purified the protein using Ni affinity chromatography. The purity and expression was determined using SDS-PAGE. We determined the secondary structure, and guanidine hydrochloride mediated unfolding, of the two proteins using circular dichroism spectroscopy. The ability of CsgF to prevent CsgA aggregation was monitored using a Thioflavin T (ThT, a dye known to bind to amyloid aggregates) and fluorescence spectroscopy.
Results & Discussion: CD spectra of both proteins obtained in 20 mM phosphate buffer were similar. Using spectral deconvolution we estimate that CsgE contains a distribution of 28% α-helical, 23 % β-sheet, and 49 % random coil structure. In the case of CsgF the distribution was estimated to be 28 % α-helical, 15 % β-sheet, and 57 % random coil structure. With regards to protein stability, both proteins exhibited weakly cooperative unfolding curves. The lack of cooperativity in the GdnHCl induced unfolding transition may be an indication that these proteins lack a well defined, and stable three-dimensional structure. Finally, with regards to its ability to effect CsgA aggregation we observed almost no increase in ThT fluorescence intensity when CsgA was incubated with CsgF indicating a lack of CsgA aggregation, and suggesting that CsgF is able to effect the association of CsgA into Curli.
Poster #: 248
Project Title: Local Backbone Dynamics of the Intrinsically Disordered Region of Atrophin-1
Author List:
Balcazar, Karen; Undergraduate, Chemistry and Biochemistry, California State University, Fullerton, Presenting Author
Abstract: Elongation of the polyglutamine (polyQ) repeat portion of the intrinsically disordered protein Atrophin-1 (ATN1) is known to result in cellular toxicity primarily at and near the nuclei of neurons, leading to a neurodegenerative disease known as dentatorubral-pallidoluysian atrophy (DRPLA). Whether a full-length or an N-terminal fragment contributes to cellular toxicity still remains unclear. Here we used site directed spin labeling electron paramagnetic resonance (SDSL-EPR) to analyze the dynamics local to a truncated portion of the polyQ repeat in ATN1 with the goal of identifying the rate and amplitude of motion as a function of polyQ-length. As lengths of the polyQ repeat greater than 38 have been identified to be pathological, four different template lengths were chosen, which had 19, 38, 57, and 76 glutamine residues. Five different sites within each ATN1 variant were selected for study by SDSL, with the intention of identifying 1) the variation of local dynamics as a function of the distance from the polyQ repeat, and 2) the effect of polyQ length on these dynamics. We observe indications of a highly flexible and disordered backbone in the regions closest to the polyQ repeat, particularly noteworthy in the longer polyQ templates, and lower mobility, higher order motion at the sites farthest from the polyQ repeat. These results provide a direct relationship between the length of the polyQ repeat and the local stability of the protein. Overall, understanding the microscopic dynamical processes responsible for the pathological aggregation of a polyQ-extended ATN1 is hugely important in elucidating the pathophysiological mechanism of (and potential treatments for) DRPLA.
Poster #: 249
Project Title: Lysophosphatidylcholine Stimulates Aggregation in Amyloidogenic L178H Human Apolipoprotein A-I
Author List:
Bhakta, Mitul; Undergraduate, Chemistry, California State University, Sacramento
Villa, Sammy; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Villarruel, Severiano; Lewis Clark College
Gutierrez, Carmina; Undergraduate, Chemistry, California State University, Sacramento, Presenting Author
Roberts, Linda; Faculty, Chemistry, California State University, Sacramento
Abstract: Apolipoprotein A-I (apoA-I), the major protein of HDL, has been shown to possess multiple cardioprotective properties. However, certain mutations case the protein to aggregate into fibrils, leading to a disease known as amyloidosis. The majority of apoA-I in vivo is bound to lipid. To understand the role of lipid in the development of aggregated protein, we examined the effect of the detergent LysoPC on aggregation of the fibrillogenic apoA-I variant L178H. Protein at two different concentrations (0.09 mg/mL and 0.25 mg/mL) was combined with LysoPC (critical micelle concentration about 7 mM) at concentrations ranging from 0 to 50 mM and incubated for 28 days. Protein aggregation was measured at various intervals during the four-week period by light scattering at 340 nm. Monomeric LysoPC stimulated protein aggregation in L178H at both protein concentrations. Micellar LysoPC stimulated aggregation only at the lower protein concentration. This result can inform the design of amphiphile-based treatments for apoA-I based amyloidosis.
Poster #: 250
Project Title: NMR characterization of the structural properties of acid-stress bacterial chaperone HdeA at pH 2.6, on the cusp of protein unfolding and activation
Author List:
Gomez, Jafaeth; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Crowhurst, Karin; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: HdeA is one of the smallest known chaperones. It is located in the periplasm of several common pathogenic bacteria and is a major contributor to the infectivity of these organisms in causing dysentery. The chaperone activity of HdeA is stimulated when the bacteria pass through the low pH environment of the stomach: HdeA associates with other proteins in the cell’s periplasm to prevent their acid-induced aggregation and to aid in bacterial survival as the organism travels through the stomach and on to infect the intestinal region of the host.
HdeA exists as an inactive dimer at physiological pH that dissociates to an active, unfolded monomer below pH 3.0. Previous experiments in our lab have been performed using NMR spectroscopy which have monitored the structural transition of HdeA from pH 6.0 to 3.0. Those results showed evidence that the protein structure loosens over that pH range and primes itself for dimer dissociation and unfolding (but does not actually start the process). The current part of our project focuses on characterizing the structure and internal flexibility of HdeA at pH 2.6. At this pH the protein is still folded, but it is on the cusp of cooperative unfolding to its active state. We have performed chemical shift titration experiments to assign both backbone and side chain resonances in preparation for further NMR characterization, and have performed preliminary experiments to assess the fast timescale motions of the HdeA backbone at pH 2.6. The dynamics experiments confirm that HdeA is not only still folded at pH 2.6, but also maintains its dimer structure. The chemical shift assignment experiments have unexpectedly revealed that a number of residues within the protein, particularly at the N-terminus, show more than one peak in the 1H-15N correlation spectrum, suggesting that those residues are involved in slow exchange between multiple conformations. This is a very interesting finding, since the N-terminus is highly unstructured at higher pH values. These results suggest that this segment of the protein has formed increased structure while the rest of the protein is preparing to become completely unstructured. With our continued work, we will be able to provide better insight, with atomic resolution, into this unfolding pathway, which has important implications in efforts to combat the devastating effects of dysentery.
NMR experiments were made possible by an MRI grant from the NSF (CHE-1040134).
Poster #: 251
Project Title: Anabaena Sensory Rhodopsin Nanodiscs to Probe Transcriptional Regulation
Author List:
de la O, Sean ; Undergraduate, Biology, Humboldt State University, Presenting Author
Shigenaga , Alexandra ; Undergraduate, Biology , Humboldt State University
Sandoval , Edward ; Undergraduate, Chemistry, Humboldt State University, Presenting Author
Dalton , Uriah; Undergraduate, Chemistry, Humboldt State University
Fuhrmann, Byran ; Graduate, Chemistry, Humboldt State University
Cappuccio, Jenny; Faculty, Chemistry, Humboldt State University
Abstract: The membrane protein Anabaena Sensory Rhodopsin (ASR) is a prokaryotic retinal containing photoactive protein, from the cyanobacterium Anabaena sp. PCC 7120, undergoes a conformational change upon absorption of orange light. This causes the, all-trans-retinal to be converted to 13-cis retinal, and the release of an associated so-called transducer protein ASRT. It has been proposed that this protein complex directly controls transcription of the cpc genes. The goal of this project is to study photo-induced transcriptional regulation properties of Anabaena Sensory Rhodopsin (ASR) and ASRT. To do this we will assemble ASR nanolipoprotein particles ASR-NLPs. NLPs are unique in that they allow for a membrane protein to be solubilized while still allowing both ends of the membrane protein to be accessed. We used a two-pronged approach to create the ASR-NLPS, using both tradition assembly and a cell-free approach. Thus far we have successfully expressed detergent solubilized ASR using current methods. We used spectroscopic methods to characterize the light adaptation of ASR, which displayed a shift of 8 nm similar to the reported shift of 12 nm. The ASR gene, alr3165, was sub-cloned into a pIVEX 2.4b Nde plasmid, which has been optimized for cell free co-expression, and confirmed by analytical digest. Next steps would include enzyme kinetic studies, atomic force microscopy to confirm ASR-NLP complex, and gel shift assay (EMSA) to determine protein-DNA sequence interactions. Understanding ASR and ASRT more thoroughly can be used to create a system where these proteins are used as photo-active transcriptional regulators. We hope to further characterize the interaction of ASR with DNA and ASRT.
Poster #: 252
Project Title: Investigating defense responses of Nicotiana benthamiana involving the 14-3-3 gene family in virus-induced effector-triggered immunity
Author List:
Spencer, Jennifer; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author, Nagel Award Finalist
Sobhanian, Soha; Graduate, Biological Science, California State University, Fullerton
Sacco, Melanie; Faculty, Biological Science, California State University, Fullerton
Abstract: Plants possess multiple tiers of immunity, the most specific of which involves immune receptors that provide effector-triggered immunity (ETI). ETI is often associated with the hypersensitive response (HR), a type of programmed cell death. The 14-3-3 gene family is conserved across eukaryotes and acts in myriad cellular processes, including plant immunity. We identified a 14-3-3 isoform from Nicotiana benthamiana that interacted with the immune receptor Tm2-2 from Solanum lycopersicum (tomato) using an HA epitope-tagged amino-terminal fragment of the Tm2-2 protein for affinity purification, followed by tandem mass spectrometry. Tm2-2 confers resistance against Tobacco mosaic virus (TMV) by recognition of the virus 30K movement protein (MP) and elicitation of defenses that include HR. Interaction between 14-3-3 proteins and Tm2-2 was verified by co-immunoprecipation with Flag epitope-tagged 14-3-3 proteins co-expressed with the HA-tagged Tm2-2 amino-terminal domain in N. benthamiana. Chemical inhibition of 14-3-3 activity in N. benthamiana using 5-aminoimidazole-4-carboxamide 1-β-D- ribofuranoside (AICAR) resulted in delayed onset and reduced development of HR-like cell death responses in leaves transiently co-expressing MP and full-length Tm2-2 by an Agrobacterium tumefaciens infiltration method. This observation supports a biological function for the Tm2-2 and 14-3-3 physical interaction detected by affinity co-purification. Furthermore, HR elicited by the unrelated immune receptor Bs2 from Capsicum anuum (pepper) in the presence of the bacterial protein AvrBs2 from Xanthomonas campestris was also diminished by AICAR treatment. These results indicate that 14-3-3 proteins play a role in Tm2-2- and Bs2-mediated signaling and may act as a common facilitator for immune receptor signaling in the plant family Solanaceae. Funding for this research was provided by National Institute of Health grant 5T34GM008612-18 to A. Cohen for the Minority Access to Research Careers Program and a California State University Junior Faculty grant to M.A. Sacco.
Poster #: 253
Project Title: Structural Basis for Antigen Recognition of a Tumor Specific Therapeutic Antibody
Author List:
Movahedin, Reza; Graduate, Chemistry, California State University, Fresno, Presenting Author
Brooks, Teresa; Faculty, Chemistry, California State University, Fresno
Brooks, Cory L. ; Faculty, Chemistry, California State University, Fresno, Presenting Author
Abstract: Antibody mediated immunotherapy of tumors is revolutionizing cancer treatment. A universal feature of cancer is aberrant protein glycosylation where new carbohydrate, and cryptic peptide epitopes normally masked from the immune system are revealed. As these epitopes are tumor specific, they represent attractive candidates as targets for therapeutic monoclonal antibodies (MAbs). MUC1 is a membrane glycoprotein of the mucin family found in epithelial cells. The protein has an extracellular VNTR (variable number of tandem repeats) domain composed of repeating segments of 20 amino acids. The VNTR region is heavily O-glycosylated in healthy epithelial tissues. However, during neoplastic transformation the VNTR region of MUC1 exhibits truncated glycosylation, exposing new cryptic peptide and carbohydrate epitopes. These features render MUC1 an ideal target for antibody-mediated immunotherapy. MAb-AR20.5 is a therapeutic antibody currently undergoing clinical development for treatment of MUC1 positive pancreatic cancer.. The antibody binds a peptide epitope within the VNTR region of MUC1. The molecular details of this interaction are uncharacterized. To further our understanding of how this antibody interacts with antigen, we have purified and crystallized Fab fragments of AR20.5 in complex with a synthetic MUC1 VNTR peptide. The crystal structure of the complex diffracted to 1.8 Å resolution and the structure reveals the nature of the interaction between AR20.5 and cancer associated MUC1. The peptide binds in a deep groove on the surface ofAR20.5 . Polar interactions to the peptide primarily occur with the light chain at the C-terminal end of MUC1. The heavy chain makes two backbone hydrogen bonds to the peptide and no interaction was observed with peptide’s N-terminal. To understand how glycosylation of MUC1 increases antibody affinity, a carbohydrate was modeled onto the putative O-glycosylation site in the VNTR peptide (Tn-antigen). In contrast to previous studies that suggested glycosylation influences antibody affinity by conformational affects, our model implies that the carbohydrate could directly interact with residues in CDR L1 and CDR H3. By elucidation the effects of antigen glycosylation we seek to improve antibody affinity and specificity for development of the next generation of therapeutics antibodies. Our results have the potential to have direct translational benefits for the improvement of treatment outcomes in pancreatic cancer.
Poster #: 254
Project Title: Characterizing the contributions of different MAGP2 domains to extracellular microfibril binding
Author List:
Daniels, Ryan; Undergraduate, Biological Science, California State University, Fullerton, Presenting Author
Miyamoto, Alison; Faculty, Biological Science, California State University, Fullerton
Abstract: Microfibril associated glycoprotein-2 (MAGP2) is a small secreted protein that binds to microfibrils (MFs). The upregulation of MAGP2 mRNA in human papillary serous ovarian carcinomas correlates to poor prognosis. This may be related to MAGP2’s ability to regulate Notch and integrin signaling that promotes recruitment of blood vessels to the tumor site. Greater understanding of how MAGP2 interacts with MFs to recruit blood vessels could give insight into possible treatments for ovarian cancer. Our lab has shown that overexpression of MAGP2 in mouse ovarian cancer cells derived from experimental tumor models colocalizes with Fibrilin-2 (Fbn-2) by using immunocytochemistry (ICC) imaging, which utilizes antibodies to locate a protein of interest in cell cultures. The carboxy-terminal half of MAGP2 (CT), containing the matrix binding domain (MBD), was shown to be necessary and sufficient for MAGP2 to bind to Fbn-2. In this study, detection of the construct expressing only the CT half of MAGP2 was achieved through the addition of 6 myc epitope tags on the amino-terminal end of the construct. When compared to full length (FL) MAGP2, the CT construct appeared to have more MAGP2-positive fibers in the extracellular matrix when immunostained (Miyamoto et al. Matrix Biol. in press). However, no conclusions could be drawn from this result because different antibodies were used to detect each construct, making them uncomparable. To be able to properly compare the CT and FL MAGP2, I made a myc-tagged FL MAGP2 construct through standard cloning techniques. The myc-tagged and untagged MAGP2 constructs were secreted as expected based on SDS-PAGE and immunoblotting. Since these constructs were able to be secreted, I was able to assess secreted MAGP2 MF colocalization using ICC. Both myc-tagged CT and myc-tagged FL MAGP2 showed similar amounts of MAGP2-positive fibers that costained for Fbn-2. This differed from previous results with untagged FL MAGP2 and myc-tagged CT MAGP2. This indicates that the initial differences were due to the different antibodies used and not due to the different constructs. In fact, it appears that the FL MAGP2 construct is just as capable of binding to MFs as the CT construct, which only contains the MBD. Further studies on the MBD, for the reduction of MAGP2 binding to MFs, are important to our understanding of MAGP2’s functions in ovarian cancer. Targeting the MBD of MAGP2 could be a possible treatment for ovarian cancer.
Poster #: 255
Project Title: Investigating Grb7 Inhibition by Use of Small Molecules
Author List:
Holmberg-Douglas, Natalie; Undergraduate, Department of Chemistry and Biochemistry, California State University, Chico, Presenting Author
Arpin, Carolynn; Faculty, Department of Chemistry and Biochemistry, California State University, Chico
Abstract: The over-expression of the Grb7 protein (human growth factor receptor bound protein 7) has been linked to various cancers including breast, ovarian, blood, and pancreatic. Grb7 elicits its function solely through protein-protein interactions (PPIs); inhibition of PPIs is a therapeutic modality that the pharmaceutical industry typically does not pursue. This novel approach requires drugs to bind to large surface areas as opposed to much smaller catalytic pockets, often rendering potential candidates too large and non-polar to ever make it to market. Excitingly, Grb7 inhibition was shown to decrease the viability of several breast cancer cell lines, reduce cell migration in pancreatic cancer cells, and delay the onset of tumors in nude mice. This established connection between abnormal Grb7 activity and cancer has rendered the protein a viable therapeutic target. Grb7 functions as an adaptor protein by binding its partners via its SH2 domain (Src homology 2); small molecules that bind the Grb7 SH2 domain have the potential to modulate protein function by rendering the protein ineffective in binding its signaling partners. To that end, previous studies have identified a benzopyrazine small molecule, which selectively binds the Grb7 SH2 domain. To further improve the efficacy of this lead molecule, we used rational design to develop a new library of potential drugs that utilize a cyclized core to enhance binding interactions between the small molecule and the Grb7 SH2 domain. The motivation, design and innovative synthesis of these Grb7 inhibitors will be presented, with focus on a novel and efficient domino cyclization reaction that was used to prepare the rigid core.
Poster #: 256
Project Title: Optimization of the Synthesis of Octavalent Glycodendrimers as Anti-HIV Agents
Author List:
Dimas, Dustin; Graduate, Department of Chemistry, California State University, Sacramento, Presenting Author
McReynolds, Katherine; Faculty, Department of Chemistry, California State University, Sacramento
Abstract: Glycodendrimers are spherical macromolecules characterized by multiple sugar-terminated ends, an organic core structure, and an ability to exhibit multivalency. The multivalent effect is the simultaneous attachment of multiple binding sites on one entity to multiple receptor sites on another, and is hypothesized to increase as the numbers of ends on a glycodendrimer are multiplied. There are two main ways to construct glycodendrimers, divergent or convergent synthesis. In divergent synthesis, the molecule is built from the dendrimer core outward. In convergent synthesis, the molecule is built by creating the outer pieces first then connecting them to the core in final step. Glycodendrimers are unique in their ability to bind to HIV virions through terminal sulfated sugars. Our research is focused on the synthesis of multivalent glycodendrimers as HIV entry inhibitors.
In the present study, a nine-step divergent pathway the was used to synthesize octavalent sugar-terminated glycodendrimers. First, the octavalent core was synthesized in six steps with an overall yield of 15.3%. Separately, an aminooxy Boc linker was combined with melibiose, gentiobiose and maltotriose to create oxime-linked sugar-linkers. The reaction was conducted in a 400 W microwave (CEM MARS 5) at 25% power for 30 minutes in 0.1 M ammonium acetate (NH4OAc), with yields of 72%, 52% and 67%, respectively. The sugar-linkers were next deprotected in TFA and CH2Cl2 to give 86%, 99% and 98% yields of the free amine-terminated sugar-linkers. In the last step, the sugar-linkers are added to the octavalent core in an amide-coupling reaction to create the final glycodendrimer products. For the melibiose sugar-linker, a yield of 21.1% resulted for the synthesis of the octavalent glycodendrimer. Further research is being conducted to determine the optimal reaction conditions for glycodendrimer synthesis to improve the yields. These conditions will then be implemented for both the gentiobiose and maltotriose sugar-linkers to create additional octavalent glycodendrimers.
Poster #: 257
Project Title: Designing Precision Medicines through the Atropisomeric Preorganization of Type-1 Kinase Inhibitors
Author List:
Smith, Davis; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Marquez, Issac ; Undergraduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Abstract: Aberrant kinase activity is prevalent in several disease states. There are currently over 25 to 30 FDA-approved kinase inhibitors for cancer therapy alone. Unfortunately, kinases possess well-conserved active sites, leading most inhibitors to bind promiscuously. This off-target binding leads to side effects. A classic strategy to remediate non-specific binding is scaffold preorganization, however this strategy often requires represents an ‘all or nothing’ strategy. We propose to address these issues through a strategy we call ‘atropisomer preorganization’ (AP). Atropisomerism is a stereochemical phenomenon based on hindered rotation around a bond where the rotational isomers are enantiomers and thus may express vastly different pharmacological profiles. Thus, rigidification of scaffolds along atropisomeric axes may prove to be a profound drug design principle, increasing the effective concentration of the target relevant confirmation, producing dramatic gains in efficacy and reductions in toxicity. The lack of selectivity among most kinase inhibitors renders them ideal starting points for systematic studies on the pharmacological effects of AP. To begin these studies we have chosen pyrrolopyrimidines (PPYs), potent, but promiscuous kinase inhibitors that often possess atropisomeric axes. Both computational and kinetic analyses have been performed on PPY derivatives containing substituents adjacent to the chiral axis. Our data shows that chlorination at the C-2 PPY position along with ortho substitution on the ‘gate keeper’ aryl group profoundly affects stereochemical stability. For instance, a PPY with a t-butyl substituent at the N-1 position, a C-2 chlorine substituent and chlorine ortho on the C-3 aryl group was experimentally determined to possess a barrier to rotation of 28.6 kcal/mol, corresponding to a t1/2 to racemization at 37 degrees C of 161 days. Replacing the C-3 chlorine with a bromine raised the t1/2 to 30.2 kcal/mol, a half-life of 2371 days or 6.5 years. Each pre-organized enantiomer is being sent out for kinase profiling to elucidate the effects of atropsiomeric preorganization on kinase selectivity and potency.
Poster #: 258
Project Title: Further Evaluation of Curcumin-Based Compounds with Terminal Heteroaromatics as Promising Anti-Cancer Agents
Author List:
Zhang, Xiaojie; Graduate, Biotechnology, California State University, Fresno, Presenting Author
Wang, Rubing; Postdoc, Chemistry, California State University, Fresno
Chen, Guanglin; Staff, Chemistry, California State University, Fresno
Dejean, Laurent; Faculty, Chemistry, California State University, Fresno
Chen, Qiao-Hong; Faculty, Chemistry, California State University, Fresno
Abstract: A novel class of curcumin-based anticancer agents, exhibiting better cytotoxicity than curcumin against two androgen-independent prostate cancer cell lines (PC-3 and DU-145), has been recently presented by us in European Journal of Medicinal Chemistry. Interestingly, the four most promising compounds are also more cytotoxic potent than curcumin against an aggressive cervical cell line (HeLa) and demonstrate no discernible cytotoxicity towards MCF-10A normal mammary epithelial cells. The aim of the current research is to explore the in-depth cell death mechanisms of these promising curcumin-based agents. To achieve this goal, we started with a systematic exploration on their effects on cell membrane integrity and cell proliferation. The cytotoxicity of this panel of curcumin analogs (32 compounds) towards HeLa cell line were tested using trypan blue dye exclusion method with a cell viability counter (Beckman). We observed that all of these compounds showed much higher inhibitory activities than curcumin at 10 uM and 1 uM concentrations. Nine compounds were selected for further evaluation of their IC50 values, which fall into the range from 0.22 uM to 0.95 uM (IC50 value for curcumin is 10.7 uM). The in vitro anti-proliferative effect of six most promising compounds towards three prostate cancer cell lines (PC-3, DU-145, and LNCaP; both androgen-dependent and androgen-independent) and of nine most promising compounds against HeLa cells was measured with a WST-1 based assay through a plate-reader (Synergy HT). All IC50 values for these selected compounds are less than 1 uM, while curcumin’s IC50 values are greater than 14.5 uM. Two compounds have been selected for further exploration of their effects on two cell death pathways (apoptosis or necrosis), which is being tested with Annexin-Ⅴ/ Sytox double staining method through flow cytometry. In this poster, we will present their anti-proliferative activity towards prostate and cervical cancer cell lines, as well as cytotoxicity against the HeLa cells. This work was financially supported by California State University-Fresno, CSUPERB New Investigator Award, and New California Ventures, LLC mini-grant.
Poster #: 259
Project Title: Development of a General Approach for the Incorporation of Fluorotyrosines in Enzymes for Unnatural Amino Acid Mutagenesis
Author List:
Colla, Alex; Graduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Ramos, Dagoberto; Undergraduate, Chemistry and Biochemistry, California State University, Long Beach, Presenting Author
Schwans, Jason; Faculty, Chemistry and Biochemistry, California State University, Long Beach
Abstract: Understanding how enzymes achieve their enormous rate enhancement has been a longstanding goal in biology, as enzymes are essential for biological function, the most common drug target, and enzymes are playing an ever increasing role in biotechnology to carry out chemical reactions in a more environmentally manner. Site-directed mutagenesis has provided a powerful and now routine tool to study enzyme function. However, the limited repertoire of naturally occurring amino acids constrains the substitutions that can be made and prevents the systematic substitutions that are needed to quantitatively dissect enzyme function. Unnatural amino acids that allow the incisive and systematic atomic-level perturbations are needed. For example, hydrogen bonds in an ‘oxyanion hole’ are a common feature of enzyme active sites and often suggested to be important for catalysis. However, water can form hydrogen bonds, so for enzyme-mediated hydrogen bonds to be catalytic the energetics of these hydrogen bonds must be different than those made with water. Site-directed mutagenesis cannot probe this question as the naturally occurring amino acids preclude systematic perturbation of the hydrogen-bonding properties. A previous study in the enzyme ketosteroid isomerase (KSI) used a series of fluorotyrosine analogs (unnatural amino acids) to perturb the pKa of the tyrosine hydrogen bond donor and the results suggested a modest catalytic contribution from the oxyanion hole hydrogen bonds. However, synthetic challenges limited the set of fluorotyrosine analogs used. To overcome these challenges and extend the series of fluorotyrosines for general use in enzymatic studies, we are developing an approach to selectively incorporate fluorotyrosines in peptides using silyl-based protecting groups. This approach provides a general and convenient method to incorporate a broad series of fluorotyrosines in peptides. To overcome challenges facing low yields in silylation reactions we used a catalyst known as the Verkade catalyst and have now incorporated the protected analogs in model peptides. These analogs and approaches offer a general and facile method for the incorporation of fluorotyrosines in enzymes for mechanistic studies and insight gained from these mechanistic studies may help guide the design of new enzymes to carry out novel functions.
This project is supported by CSULB Startup funds and a Cottrell College Science Award from the Research Corporation for Science Advancement.
Poster #: 260
Project Title: Mechanistic investigation of ketone transfer hydrogenation catalyzed by asymmetric bisterpyridine bridged ruthenium dimers.
Author List:
Berganza, Juan; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Holt, Tina; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Kelson, Eric; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: The development of homogeneous catalysts remains a subject of intense research interest particularly for their potential to support pharmaceutically important reactions. Ideally researchers want to connect catalyst design to the needed selectivity or enantioselectivity of the supported reaction, but this remains elusive for current transfer hydrogenation catalyst designs that rely on weak (and often unpredictable) non-covalent interactions between catalyst and substrate. The Kelson group at CSUN has developed dimeric ruthenium catalysts for ketone transfer hydrogenation (using 2-propanol as a hydrogen source) that are intended to covalently bind ketone substrates at specific catalytic sites. These dimers feature two ruthenium centers bound and electronically coupled by bisterpyridine ligands with one hosting the active site and the other surrounded by terpyridine ligands and acting only as an electronic support. In order to confirm that substrate coordination indeed occurs in the catalytic mechanism of these dimers as intended, this paper reports an extensive kinetic study of the catalytic transfer hydrogenation of acetophenones by asymmetric bisterpyridine bridged ruthenium dimers (particularly with supporting tricyclohexylphosphine bound near the active site). The reaction behavior was indeed consistent with ketone coordination to a hydride intermediate followed by hydride transfer to the bound ketone, exchange of the product for solvent alcohol, and reformation of the hydride intermediate to close the catalytic cycle. Kinetics with substituted acetophenones provide evidence of negative charge accumulation on the substrate during hydride transfer suggesting that the timing of the bond making and breaking processes are not entirely synchronized. Further, the use of perdeuterated 2-propanol solvent nearly stopped the reaction with a very large primary kinetic isotope effect indicating that the hydride transfer involves hydride tunneling through a high but narrow activation barrier. This work confirms that the asymmetric bisterpyridine bridged ruthenium dimers prepared in the Kelson group indeed bind ketone substrates in catalyzing transfer hydrogenation and that the hydride transfer process has unusual features that could be exploited for designed selectivity in next generation catalysts. We thank CSUPERB (Research Development Grant), the NIH (SCORE S06 GM48680), ACS Petroleum Research Fund, and CSUN Office of Sponsored Projects for support of this work.
Poster #: 261
Project Title: Syntheses and Binding Studies of Novel Benzimidazole Compounds Targeting the Hepatitis C Virus Internal Ribosome Entry Site
Author List:
Kanner, Arielle; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Cholewczynski, Anna; Undergraduate, Chemistry and Biochemistry, San Diego State University
Schmit, David; Graduate, Chemistry and Biochemistry, San Diego State University
Milewicz, Urszula; Graduate, Chemistry and Biochemistry, San Diego State University
Wolkowicz, Roland; Faculty, Biology, San Diego State University
Bergdahl, Mikael; Faculty, Chemistry and Biochemistry, San Diego State University
Abstract: Over 200 million people have been infected with Hepatitis C virus (HCV) worldwide. According to the CDC, chronic HCV infection affects over 3 million Americans and has surpassed HIV as a leading cause of death in the US, making it a major threat to human health. Current interferon, ribavirin, protease, and polymerase treatments suffer from unbearable side effects and limited effectiveness. Recently, a new class of small drugs was discovered that acts against HCV in a new way, binding to a part of the highly conserved 5′ untranslated region of the viral RNA. Though the RNA virus is known to mutate at a relatively fast rate, the ability to target the highly conserved internal ribosome entry site is a major advantage to this novel method. This innovative mode of translational inhibition causes a conformational change in the virus RNA, which halts translation of the virus.
A novel synthesis for a streamlined synthesis of a library of functionalized benzimidazole analogs will be presented. The key innovation of attaching variable side chains at a late stage in our synthesis has afforded the ability to rapidly synthesize derivatives expected to have increased potency. Our published crystal structure of bound original inhibitor (EC50 = 3.4 micro-M) with HCV RNA revealed several key binding interactions, which are now used as a guide for the synthesis of future inhibitors to increase potency. The presented library currently shows three directions for increasing affinity: conformational restriction, optimization of amine-phosphate salt bridges, and to incorporate aryl ring substitutions. Novel compounds have been submitted and show excellent activities against HCV (EC50: 22-89 micro-M) in FRET assays and cell line studies. Although general trends are difficult to observe at this early stage of the SAR study, our small library has already shown that conformation restriction, carbon tether chain length, and heterocyclic groups all play important roles in compound activity and binding. In summary, the crystal structure has made it possible for us to synthesize a highly targeted group of compounds predicted to greatly increase potency of new anti-HCV medications.
Acknowledgements: Funding for this project has been provided by NIH, SDSU Foundation and CSUPERB (FS-grant, 2013).
Poster #: 262
Project Title: Ball milling as an approach to self-assemble molecular capsules for biotechnological applications
Author List:
Journey, Sara; Undergraduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Teppang, Kristine; Undergraduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Martin, Sadie; Graduate, Chemistry and Biochemistry, San Diego State University
Purse, Byron; Faculty, Chemistry and Biochemistry, San Diego State University
Abstract: Chemists are currently studying molecular encapsulation as a means to stabilize and store small molecules for release when they are needed. Future applications of molecular encapsulation include drug delivery, environmental remediation, and the control of chemical reactions. A great limitation of currently available molecular capsules is that most entrap and stabilize their occupants in a dynamic equilibrium: most of a population of guest molecules are encapsulated, but they rapidly enter and exit the capsules, and so are exposed to the surrounding chemical milieu. Real world applications for molecular encapsulation will, however, require kinetically stable guest entrapment, which means that guest exchange from the capsules is slow. Our group has shown that melting mixtures of a molecular capsule called a pyrogallolarene hexamer with small molecule guests followed by cooling can produce kinetically stable encapsulation complexes, but this method is limited by the high temperatures required, which can lead to the decomposition of prospective guest molecules. However, the use of a ball mill for molecular capsule formation by physically grinding mixtures of powders has yet to be explored. By experimenting with the use of ball mills, we are replacing the application of thermal energy from the melting method and instead utilizing mechanical energy from the ball mills to encapsulate guest species. Throughout this encapsulation process, the use of solvent is avoided, which reduces chemical waste. Our data has proven the success of encapsulation through mechanical force as we have sampled a variety of guest species including pyrene, flouranthene, and flourene. Simply after 10 minutes of ball milling at 30 Hz, all of the aforesaid species were successfully encapsulated as proven by NMR. Currently, solid state NMR is being used to confirm the capability of applied mechanical energy from ball milling. Further applications of ball milling will be explored such as its capacity to encapsulate other guest molecules not previously examined as well as its use with other types of capsules which can encapsulate polar guest species. The most recent results of our investigation of this method will be reported.
Poster #: 263
Project Title: New asymmetric ruthenium dimers as catalysts for pharmaceutically important ketone transfer hydrogenation reactions.
Author List:
Holt, Tina; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Berganza, Juan; Undergraduate, Chemistry and Biochemistry, California State University, Northridge, Presenting Author
Kelson, Eric; Faculty, Chemistry and Biochemistry, California State University, Northridge
Abstract: Homogeneous catalysts have been of continued pharmaceutical interest for their promise for designer selectivity and enantioselectivity. Efforts to achieve this for ketone transfer hydrogenation catalysts, however, have been particularly difficult due to their traditional dependence on weak (and often unreliable) non-covalent interactions between the catalyst and substrate. Our laboratory has been investigating a new class of inner-sphere ketone transfer hydrogenation catalysts that covalently bind substrates making them more suitable for design-for-reactivity strategies. The first generation of these catalysts were terpyridine supported ruthenium monomers that were subsequently found by mass spectroscopy to spontaneously dimerize through its pendent bases into the actual catalytic intermediates. Unfortunately, the self assembly of these dimers could not be controlled to impose selectivity through the monomer designs. Since electronic cooperation within dimer intermediates was clearly important to catalysis, we report here the direct preparation of ruthenium dimers featuring bisterpyridine ligands that chemically bind and electronically couple the two metal centers. These dimers feature one ruthenium that hosts the active site and another that only provides electronic support. These complexes indeed catalyze transfer hydrogenation of aromatic, aliphatic, and bulky ketones as well as alkenes (though at a slower rate). A survey of ancillary (supporting) ligands found that coordinating phosphines near the catalytic active site dramatically improves activity (with tricyclohexylphoshine being the best). Control experiments with monomeric analogs exhibited very little to no activity suggesting that the metal-metal cooperation is indeed important. The presence of mixed-valent intermediates was suggested by spectroscopy of reaction solutions, but these appear to represent a reversible and unproductive dead-end from the deprotonation of catalytic hydrides. Electrochemical surveys of the catalytic dimers may offer additional clues of metal-metal cooperation. Overall, this work reports the direct preparation of bisterpyridine bridged ruthenium dimers that efficiently catalyze ketone transfer hydrogenation and could represent a new design for pharmaceutically useful catalysts. We thank CSUPERB (Research Development Grant), the NIH (SCORE S06 GM48680), ACS Petroleum Research Fund, and CSUN Office of Sponsored Projects for support of this work.
Poster #: 264
Project Title: Atropisomerically Preorganized α-Helix Mimics: A small molecule ‘peptide stapling’ approach towards Effective Inhibitors of Anti-Apoptotic Proteins
Author List:
Gabra, Mari; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Madrid, Danae; Graduate, Chemistry and Biochemistry, San Diego State University, Presenting Author
Abstract: Apoptosis is a highly regulated process that is important for tissue homeostasis. The intrinsic pathway acts via the mitochondria and is dependent on several pro-and anti-apoptotic Bcl-2 proteins. p53 is a tumor suppressing transcription factor that induces the translation of pro-apoptotic Bcl-2 proteins. Each of these systems are regulated by key protein-helical interactions (PHIs). Abnormal levels of these proteins are bona fide oncongenic transformations in myriad cancers. Motivated by this we have begun a research program to design and synthesize small molecules α-helical mimetics that can inhibit these important PHIs. Atropisomerism is a stereochemical phenomenon that arises from hindered rotation around a bond (axis of chirality) that results in a molecule whose ‘rotational’ isomers are enantiomers. Terephthalamide based foldamers have been shown to display functionality in such a way as to mimic the i, i+4, and i+7 positions of an α-helix. These scaffolds, which exist as interconverting atropisomers, are known to inhibit the p53-hDM2 and Bcl-XL-Bak PHIs at nanomolar concentrations. There is a degree of flexibility around the atropisomeric axis of these scaffolds that allows for an induced fit onto the protein, but with a great entropic cost. We are working on developing a synthetic route towards atropisomerically stable analogs of these and related scaffolds that are preorganized into the correct α-helical conformation along an axis of chirality, with the hypothesis that such analogs will possess greater efficacy akin to what is observed in the peptide stapling literature. The established importance of atropisomerism on these PHIs, as well as the need for selective inhibitors of anti-apoptotic proteins for cancer therapy renders these proteins an ideal starting point to study the biological implications of atropisomeric preorganization (AP). Thus far, we have synthesized the basic terephthalamide scaffold and are currently developing a method for the introduction of steric hindrance around the amide bond by via C-H functionalization. In the absence of enantioselectivity we have begun HPLC studies towards developing a chiral separation of racemic scaffolds. Once optimized, we will synthesize a small library of enantiopure terephthalamides that will be characterized via Fluorescence Polarization, MTT assays, and Isothermal Titration Calorimetry to probe the effects of AP on PHI inhibition.